Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UQCRB cdna clone

UQCRB cDNA Clone

Gene Names
UQCRB; QPC; QCR7; QP-C; UQBC; UQBP; UQPC; UQCR6; MC3DN3
Synonyms
UQCRB; UQCRB cDNA Clone; UQCRB cdna clone
Ordering
For Research Use Only!
Sequence
atggctggtaagcaggccgtttcagcatcaggcaagtggctggatggtattcgaaaatggtattacaatgctgcaggattcaataaactggggttaatgcgagatgatacaatatacgaggatgaagatgtaaaagaagccataagaagacttcctgagaacctttataatgacaggatgtttcgcattaagagggcactggacctgaacttgaagcatcagatcttgcctaaagagcagtggaccaaatatgaagaggaaaatttctaccttgaaccgtatctgaaagaggttattcgggaaagaaaagaaagagaagaatgggcaaagaagtaa
Sequence Length
336
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,267 Da
NCBI Official Full Name
Homo sapiens ubiquinol-cytochrome c reductase binding protein, mRNA
NCBI Official Synonym Full Names
ubiquinol-cytochrome c reductase binding protein
NCBI Official Symbol
UQCRB
NCBI Official Synonym Symbols
QPC; QCR7; QP-C; UQBC; UQBP; UQPC; UQCR6; MC3DN3
NCBI Protein Information
cytochrome b-c1 complex subunit 7
UniProt Protein Name
Cytochrome b-c1 complex subunit 7
Protein Family
UniProt Gene Name
UQCRB
UniProt Synonym Gene Names
UQBP
UniProt Entry Name
QCR7_HUMAN

NCBI Description

This gene encodes a subunit of the ubiquinol-cytochrome c oxidoreductase complex, which consists of one mitochondrial-encoded and 10 nuclear-encoded subunits. The protein encoded by this gene binds ubiquinone and participates in the transfer of electrons when ubiquinone is bound. This protein plays an important role in hypoxia-induced angiogenesis through mitochondrial reactive oxygen species-mediated signaling. Mutations in this gene are associated with mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. Related pseudogenes have been identified on chromosomes 1, 5 and X. [provided by RefSeq, Dec 2011]

Uniprot Description

UQCRB: This is a component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain. This component is involved in redox-linked proton pumping. Defects in UQCRB are a cause of mitochondrial complex III deficiency (MT-C3D). A disorder of the mitochondrial respiratory chain resulting in a highly variable phenotype depending on which tissues are affected. Clinical features include mitochondrial encephalopathy, psychomotor retardation, ataxia, severe failure to thrive, liver dysfunction, renal tubulopathy, muscle weakness and exercise intolerance. Belongs to the UQCRB/QCR7 family.

Protein type: Energy Metabolism - oxidative phosphorylation; Oxidoreductase; Mitochondrial; EC 1.10.2.2

Chromosomal Location of Human Ortholog: 8q22

Cellular Component: mitochondrial inner membrane; mitochondrial respiratory chain; mitochondrial respiratory chain complex III

Molecular Function: protein binding; ubiquinol-cytochrome-c reductase activity

Biological Process: aerobic respiration; mitochondrial electron transport, ubiquinol to cytochrome c; oxidative phosphorylation

Disease: Mitochondrial Complex Iii Deficiency, Nuclear Type 3

Research Articles on UQCRB

Similar Products

Product Notes

The UQCRB uqcrb (Catalog #AAA1274319) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctggta agcaggccgt ttcagcatca ggcaagtggc tggatggtat tcgaaaatgg tattacaatg ctgcaggatt caataaactg gggttaatgc gagatgatac aatatacgag gatgaagatg taaaagaagc cataagaaga cttcctgaga acctttataa tgacaggatg tttcgcatta agagggcact ggacctgaac ttgaagcatc agatcttgcc taaagagcag tggaccaaat atgaagagga aaatttctac cttgaaccgt atctgaaaga ggttattcgg gaaagaaaag aaagagaaga atgggcaaag aagtaa. It is sometimes possible for the material contained within the vial of "UQCRB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.