Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UIMC1 cdna clone

UIMC1 cDNA Clone

Gene Names
UIMC1; RAP80; X2HRIP110
Synonyms
UIMC1; UIMC1 cDNA Clone; UIMC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccacggagaaagaaaaaagttaaagaagtctccgaatctcggaacctggagaagaaggatgtggaaactaccagttctgtcagtgtgaagaggaagcgtagacttgaggatgcattcattgtgatatccgatagtgatggagaggaaccaaaggaggaaaatgggttgcagaaaacgaagacaaaacagtcgaatagagcaaagtgtttggccaaaagaaaaattgcacagatgacagaagaagaacagtttgctctggctctcaaaatgagtgagcaggaagctagggaggtgaacagccaggaggaggaagaagaggagctcttgaggaaagccattgctgaaagcctgaatagttgccggccttctgatgcttccgctaccagatctcgacctctggccactggaccgtcttcccagtcccatcaagagaaaaccacagactctgggctcactgaaggcatatggcagctggtacctccatcactgtttaaaggctcacatatcagtcagggaaacgaggctgaggaaagagaggagccttgggaccacactgaaaaaactgaagaggagccggtctctggcagctcaggaagctgggaccagtcaagccagccagtgtttgagaatgtgaacgttaaatcttttgacagatgtactggccactcggctgagcacacacagtgtgggaagccacagtcttcccaagggattgttgaagaaacttctgaagagggaaactctgtacctgcttcacaaagtgttgctgctttgaccagtaagagaagcttagtccttatgccagagagttctgcagaagaaatcactgtttgtcctgagacacagctaagttcctctgaaacttttgaccttgaaagagaagtctctccaggtagcagagatatcttggatggagtcagaataataatggcagataaggaggttggtaacaaggaagatgctgagaaggaagtagctatttctaccttctcatccagtaaccaggtatcctgcccgctatgtgaccaatgctttccacccacaaagattgaacgacatgccatgtactgcaatggtctgatggaggaagatacagtattgactcggagacaaaaagaggccaagaccaagagtgacagtgggacagctgcccagacttctctagacattgacaagaatgagaagtgttacctctgtaaatccctggtcccatttagagagtatcagtgtcatgtggactcctgtctccagcttgcaaaggctgaccaaggagatggacctgaagggagtggaagagcatgttcaactgtggaggggaagtggcagcagaggctgaagaacccaaaggaaaaaggccacagtgaaggccgactccttagtttcttggaacagtctgagcacaagacttcagatgcagacatcaagtcttcagaaacaggagccttcagggtgccttcaccagggatggaagaggcaggctgcagcagagagatgcagagttctttcacacgtcgtgacttaaatgaatctcccgtcaagtcttttgtttccatttcagaagccacagattgcttagtggactttaaaaagcaagttactgtccagccaggtagtcggacacggaccaaagctggcagaggaagaaggagaaaattctga
Sequence Length
1662
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,412 Da
NCBI Official Full Name
Homo sapiens ubiquitin interaction motif containing 1, mRNA
NCBI Official Synonym Full Names
ubiquitin interaction motif containing 1
NCBI Official Symbol
UIMC1
NCBI Official Synonym Symbols
RAP80; X2HRIP110
NCBI Protein Information
BRCA1-A complex subunit RAP80
UniProt Protein Name
BRCA1-A complex subunit RAP80
Protein Family
UniProt Gene Name
UIMC1
UniProt Synonym Gene Names
RAP80; RXRIP110
UniProt Entry Name
UIMC1_HUMAN

NCBI Description

This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Uniprot Description

RAP80: Ubiquitin-binding protein that specifically recognizes and binds 'Lys-63'-linked ubiquitin. Plays a central role in the BRCA1-A complex by specifically binding 'Lys-63'-linked ubiquitinated histones H2A and H2AX at DNA lesions sites, leading to target the BRCA1-BARD1 heterodimer to sites of DNA damage at double-strand breaks (DSBs). The BRCA1-A complex also possesses deubiquitinase activity that specifically removes 'Lys-63'-linked ubiquitin on histones H2A and H2AX. Also weakly binds monoubiquitin but with much less affinity than 'Lys-63'-linked ubiquitin. May interact with monoubiquitinated histones H2A and H2B; the relevance of such results is however unclear in vivo. Does not bind Lys-48'-linked ubiquitin. May indirectly Act as a transcriptional repressor by inhibiting the interaction of NR6A1 with the corepressor NCOR1. Interacts with TSP57. Component of the BRCA1-A complex, at least composed of the BRCA1, BARD1, UIMC1/RAP80, FAM175A/Abraxas, BRCC3/BRCC36, BRE/BRCC45 and BABAM1/NBA1. In the BRCA1-A complex, interacts directly with FAM175A/Abraxas. Interacts with ESR1, NR6A1 and UBE2I. Expressed in testis, ovary, thymus and heart. Expressed in germ cells of the testis. Belongs to the RAP80 family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 5q35.2

Cellular Component: nucleoplasm; nucleus

Molecular Function: histone binding; protein binding

Biological Process: double-strand break repair; double-strand break repair via nonhomologous end joining; G2/M transition DNA damage checkpoint; negative regulation of transcription, DNA-dependent; positive regulation of DNA repair; response to ionizing radiation

Research Articles on UIMC1

Similar Products

Product Notes

The UIMC1 uimc1 (Catalog #AAA1274267) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccacgga gaaagaaaaa agttaaagaa gtctccgaat ctcggaacct ggagaagaag gatgtggaaa ctaccagttc tgtcagtgtg aagaggaagc gtagacttga ggatgcattc attgtgatat ccgatagtga tggagaggaa ccaaaggagg aaaatgggtt gcagaaaacg aagacaaaac agtcgaatag agcaaagtgt ttggccaaaa gaaaaattgc acagatgaca gaagaagaac agtttgctct ggctctcaaa atgagtgagc aggaagctag ggaggtgaac agccaggagg aggaagaaga ggagctcttg aggaaagcca ttgctgaaag cctgaatagt tgccggcctt ctgatgcttc cgctaccaga tctcgacctc tggccactgg accgtcttcc cagtcccatc aagagaaaac cacagactct gggctcactg aaggcatatg gcagctggta cctccatcac tgtttaaagg ctcacatatc agtcagggaa acgaggctga ggaaagagag gagccttggg accacactga aaaaactgaa gaggagccgg tctctggcag ctcaggaagc tgggaccagt caagccagcc agtgtttgag aatgtgaacg ttaaatcttt tgacagatgt actggccact cggctgagca cacacagtgt gggaagccac agtcttccca agggattgtt gaagaaactt ctgaagaggg aaactctgta cctgcttcac aaagtgttgc tgctttgacc agtaagagaa gcttagtcct tatgccagag agttctgcag aagaaatcac tgtttgtcct gagacacagc taagttcctc tgaaactttt gaccttgaaa gagaagtctc tccaggtagc agagatatct tggatggagt cagaataata atggcagata aggaggttgg taacaaggaa gatgctgaga aggaagtagc tatttctacc ttctcatcca gtaaccaggt atcctgcccg ctatgtgacc aatgctttcc acccacaaag attgaacgac atgccatgta ctgcaatggt ctgatggagg aagatacagt attgactcgg agacaaaaag aggccaagac caagagtgac agtgggacag ctgcccagac ttctctagac attgacaaga atgagaagtg ttacctctgt aaatccctgg tcccatttag agagtatcag tgtcatgtgg actcctgtct ccagcttgca aaggctgacc aaggagatgg acctgaaggg agtggaagag catgttcaac tgtggagggg aagtggcagc agaggctgaa gaacccaaag gaaaaaggcc acagtgaagg ccgactcctt agtttcttgg aacagtctga gcacaagact tcagatgcag acatcaagtc ttcagaaaca ggagccttca gggtgccttc accagggatg gaagaggcag gctgcagcag agagatgcag agttctttca cacgtcgtga cttaaatgaa tctcccgtca agtcttttgt ttccatttca gaagccacag attgcttagt ggactttaaa aagcaagtta ctgtccagcc aggtagtcgg acacggacca aagctggcag aggaagaagg agaaaattct ga. It is sometimes possible for the material contained within the vial of "UIMC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.