Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SYNE2 cdna clone

SYNE2 cDNA Clone

Gene Names
SYNE2; NUA; EDMD5; Nesp2; TROPH; NUANCE; SYNE-2; Nesprin-2
Synonyms
SYNE2; SYNE2 cDNA Clone; SYNE2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcatctagtcctgagcttcccaccgaagatgaacagggttcctggggcatcgacgatctccatatttcattgcaagctgaacaggaagacacccagaagaaagccttcacgtgctggataaactcacagttggccaggcacacttctccctcagttatatccgacctattcacagacattaaaaaggggcatgtcctcctggatctgctagaagtactttctgggcaacagttgcctcgggataaaggatctaataccttccagtgtagaatcaatatagaacatgccttgacattcctaagaaaccgatcaattaagctaataaatattcatgttactgatatcattgatggaaacccatccattatccttggcctaatttggacaattatcctgcactttcatattgagaagcttgcccagactctttcttgcaattacaatcagccttccctggatgatgtgagtgtggttgactcatctcctgcctcaagtcctccagctaagaaatgctctaaagtgcaagcaagatggcaaatgtctgcaagaaaggcccttcttttgtgggctcaggaacaatgcgccacctatgagtctgtcaatgtgaccgattttaagtcaagttggagaaatgggatggcttttttggccatcattcatgccttgcgaccagacctaattgacatgaagagtgtgaagcatagatccaacaaagacaatctgagagaggccttcagaattgcagaacaagaattaaaaatccccagattgctggaaccagaagatgcctggagaagttctgcactttacagaatttatatgcctggcacagtgtcttgtgccagctacttgtga
Sequence Length
858
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
119,457 Da
NCBI Official Full Name
Homo sapiens spectrin repeat containing, nuclear envelope 2, mRNA
NCBI Official Synonym Full Names
spectrin repeat containing nuclear envelope protein 2
NCBI Official Symbol
SYNE2
NCBI Official Synonym Symbols
NUA; EDMD5; Nesp2; TROPH; NUANCE; SYNE-2; Nesprin-2
NCBI Protein Information
nesprin-2
UniProt Protein Name
Nesprin-2
Protein Family
UniProt Gene Name
SYNE2
UniProt Synonym Gene Names
KIAA1011; NUA; Protein NUANCE; Syne-2
UniProt Entry Name
SYNE2_HUMAN

NCBI Description

The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

Uniprot Description

SYNE2: a nuclear transmembrane protein involved in the maintenance of nuclear organization and structural integrity. The largest part of the protein is cytoplasmic, while its C-terminal part is associated with the nuclear envelope, most probably the outer nuclear membrane. Remains associated with the nuclear envelope during its breakdown in mitotic cells. Probable anchoring protein which theters the nucleus to the cytoskeleton. Connects nuclei to the cytoskeleton by interacting with the nuclear envelope and with F-actin in the cytoplasm. Nine alternatively spliced isoforms have been described.

Protein type: Membrane protein, integral; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 14q23.2

Cellular Component: cytoplasm; filopodium membrane; focal adhesion; intermediate filament cytoskeleton; mitochondrion; nuclear envelope; nuclear lumen; nuclear membrane; nucleus; sarcoplasmic reticulum; Z disc

Molecular Function: actin binding; protein binding

Biological Process: centrosome localization; nuclear migration; nuclear migration along microfilament; positive regulation of cell migration

Disease: Emery-dreifuss Muscular Dystrophy 5, Autosomal Dominant

Research Articles on SYNE2

Similar Products

Product Notes

The SYNE2 syne2 (Catalog #AAA1274251) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatcta gtcctgagct tcccaccgaa gatgaacagg gttcctgggg catcgacgat ctccatattt cattgcaagc tgaacaggaa gacacccaga agaaagcctt cacgtgctgg ataaactcac agttggccag gcacacttct ccctcagtta tatccgacct attcacagac attaaaaagg ggcatgtcct cctggatctg ctagaagtac tttctgggca acagttgcct cgggataaag gatctaatac cttccagtgt agaatcaata tagaacatgc cttgacattc ctaagaaacc gatcaattaa gctaataaat attcatgtta ctgatatcat tgatggaaac ccatccatta tccttggcct aatttggaca attatcctgc actttcatat tgagaagctt gcccagactc tttcttgcaa ttacaatcag ccttccctgg atgatgtgag tgtggttgac tcatctcctg cctcaagtcc tccagctaag aaatgctcta aagtgcaagc aagatggcaa atgtctgcaa gaaaggccct tcttttgtgg gctcaggaac aatgcgccac ctatgagtct gtcaatgtga ccgattttaa gtcaagttgg agaaatggga tggctttttt ggccatcatt catgccttgc gaccagacct aattgacatg aagagtgtga agcatagatc caacaaagac aatctgagag aggccttcag aattgcagaa caagaattaa aaatccccag attgctggaa ccagaagatg cctggagaag ttctgcactt tacagaattt atatgcctgg cacagtgtct tgtgccagct acttgtga. It is sometimes possible for the material contained within the vial of "SYNE2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.