Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CRB3 cdna clone

CRB3 cDNA Clone

Synonyms
CRB3; CRB3 cDNA Clone; CRB3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaaccccgggctggggctgcttctggcgctgggcctgccgttcctgctggcccgctggggccgagcctgggggcaaatacagaccacttctgcaaatgagaatagcactgttttgccttcatccaccagctccagctccgatggcaacctgcgtccggaagccatcactgctatcatcgtggtcttctccctcttggctgccttgctcctggctgtggggctggcactgttggtgcggaagcttcgggagaagcggcagacggagggcacctaccggcccagtagcgaggagcagttctcccatgcagccgaggcccgggcccctcaggactccaaggagacggtgcagggctgcctgcccatctag
Sequence Length
372
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,113 Da
NCBI Official Full Name
Homo sapiens crumbs homolog 3 (Drosophila), mRNA
NCBI Official Synonym Full Names
crumbs 3, cell polarity complex component
NCBI Official Symbol
CRB3
NCBI Protein Information
protein crumbs homolog 3
UniProt Protein Name
Protein crumbs homolog 3
Protein Family
UniProt Gene Name
CRB3
UniProt Entry Name
CRUM3_HUMAN

NCBI Description

This gene encodes a member of the Crumbs family of proteins. This gene is widely expressed in epithelial tissues where the encoded protein isoforms play various roles such as the control of cytokinesis and ciliogenesis or the formation of tight junctions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]

Uniprot Description

CRB3: Involved in the establishment of cell polarity in mammalian epithelial cells. Regulates the morphogenesis of tight junctions. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Membrane protein, integral; Cell adhesion

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cell junction; plasma membrane

Molecular Function: protein binding; protein domain specific binding; SH3 domain binding

Research Articles on CRB3

Similar Products

Product Notes

The CRB3 crb3 (Catalog #AAA1274246) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaacc ccgggctggg gctgcttctg gcgctgggcc tgccgttcct gctggcccgc tggggccgag cctgggggca aatacagacc acttctgcaa atgagaatag cactgttttg ccttcatcca ccagctccag ctccgatggc aacctgcgtc cggaagccat cactgctatc atcgtggtct tctccctctt ggctgccttg ctcctggctg tggggctggc actgttggtg cggaagcttc gggagaagcg gcagacggag ggcacctacc ggcccagtag cgaggagcag ttctcccatg cagccgaggc ccgggcccct caggactcca aggagacggt gcagggctgc ctgcccatct ag. It is sometimes possible for the material contained within the vial of "CRB3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.