Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STAU1 cdna clone

STAU1 cDNA Clone

Gene Names
STAU1; STAU; PPP1R150
Synonyms
STAU1; STAU1 cDNA Clone; STAU1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcaagttcaagtgcaagttcagaacccatctgctgctctctcagggagccaaatactgaacaagaaccagtctcttctctcacagcctttgatgagtattccttctactactagctctctgccctctgaaaatgcaggtagacccattcaaaactctgctttaccctctgcatctattacatccaccagtgcagctgcagaaagcataacccctactgtagaactaaatgcactgtgcatgaaacttggaaaaaaaccaatgtataagcctgttgacccttactctcggatgcagtccacctataactacaacatgagaggaggtgcttatcccccgaggtacttttacccatttccagttccacctttactttatcaagtggaactttctgtgggaggacagcaatttaatggcaaaggaaagacaagacaggctgcgaaacacgatgctgctgccaaagcgttgaggatcctgcagaatgagcccctgccagagaggctggaggtgaatggaagagaatccgaagaagaaaatctcaataaatctgaaataagtcaagtgtttgagattgcacttaaacggaacttgcctgtgaatttcgaggtggcccgggagagtggcccaccccacatgaagaactttgtgaccaaggtttcggttggggagtttgtgggggaaggtgaagggaaaagcaagaagatttcaaagaaaaatgccgccatagctgttcttgaggagctgaagaagttaccgcccctgcctgcagttgaacgagtaaagcctagaatcaaaaagaaaacaaaacccatagtcaagccacagacaagcccagaatatggccaggggatcaatccgattagccgactggcccagatccagcaggcaaaaaaggagaaggagccagagtacacgctcctcacagagcgaggcctcccgcgccgcagggagtttgtgatgcaggtgaaggttggaaaccacactgcagaaggaacgggcaccaacaagaaggtggccaagcgcaatgcagccgagaacatgctggagatccttggtttcaaagtcccgcaggcgcagcccaccaaacccgcactcaagtcagaggagaagacacccataaagaaaccaggggatggaagaaaagtaaccttttttgaacctggctctggggatgaaaatgggactagtaataaagaggatgagttcaggatgccttatctaagtcatcagcagctgcctgctggaattcttcccatggtgcccgaggtcgcccaggctgtaggagttagtcaaggacatcacaccaaagattttaccagggcagctccgaatcctgccaaggccacggtaactgccatgatagcccgagagttgttgtatgggggcacctcgcccacagccgagaccattttaaagaataacatctcttcaggccacgtaccccatggacctctcacgagaccctctgagcaactggactatctttccagagtccagggattccaggttgaatacaaagacttccccaaaaacaacaagaacgaatttgtatctcttatcaattgctcctctcagccacctctgatcagccatggtatcggcaaggatgtggagtcctgccatgatatggctgcgctgaacatcttaaagttgctgtctgagttggaccaacaaagtacagagatgccaagaacaggaaacggaccaatgtctgtgtgtgggaggtgctga
Sequence Length
1734
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,635 Da
NCBI Official Full Name
Homo sapiens staufen, RNA binding protein, homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
staufen double-stranded RNA binding protein 1
NCBI Official Symbol
STAU1
NCBI Official Synonym Symbols
STAU; PPP1R150
NCBI Protein Information
double-stranded RNA-binding protein Staufen homolog 1
UniProt Protein Name
Double-stranded RNA-binding protein Staufen homolog 1
UniProt Gene Name
STAU1
UniProt Synonym Gene Names
STAU
UniProt Entry Name
STAU1_HUMAN

NCBI Description

Staufen is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. The human homologue of staufen encoded by STAU, in addition contains a microtubule- binding domain similar to that of microtubule-associated protein 1B, and binds tubulin. The STAU gene product has been shown to be present in the cytoplasm in association with the rough endoplasmic reticulum (RER), implicating this protein in the transport of mRNA via the microtubule network to the RER, the site of translation. Five transcript variants resulting from alternative splicing of STAU gene and encoding three isoforms have been described. Three of these variants encode the same isoform, however, differ in their 5'UTR. [provided by RefSeq, Jul 2008]

Uniprot Description

STAU: Binds double-stranded RNA (regardless of the sequence) and tubulin. May play a role in specific positioning of mRNAs at given sites in the cell by cross-linking cytoskeletal and RNA components, and in stimulating their translation at the site. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding

Chromosomal Location of Human Ortholog: 20q13.1

Cellular Component: cytoplasm; dendrite; endoplasmic reticulum; membrane; microtubule associated complex; plasma membrane; stress granule

Molecular Function: protein binding

Biological Process: positive regulation of viral genome replication; positive regulation of viral protein levels in host cell

Research Articles on STAU1

Similar Products

Product Notes

The STAU1 stau1 (Catalog #AAA1274147) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcaag ttcaagtgca agttcagaac ccatctgctg ctctctcagg gagccaaata ctgaacaaga accagtctct tctctcacag cctttgatga gtattccttc tactactagc tctctgccct ctgaaaatgc aggtagaccc attcaaaact ctgctttacc ctctgcatct attacatcca ccagtgcagc tgcagaaagc ataaccccta ctgtagaact aaatgcactg tgcatgaaac ttggaaaaaa accaatgtat aagcctgttg acccttactc tcggatgcag tccacctata actacaacat gagaggaggt gcttatcccc cgaggtactt ttacccattt ccagttccac ctttacttta tcaagtggaa ctttctgtgg gaggacagca atttaatggc aaaggaaaga caagacaggc tgcgaaacac gatgctgctg ccaaagcgtt gaggatcctg cagaatgagc ccctgccaga gaggctggag gtgaatggaa gagaatccga agaagaaaat ctcaataaat ctgaaataag tcaagtgttt gagattgcac ttaaacggaa cttgcctgtg aatttcgagg tggcccggga gagtggccca ccccacatga agaactttgt gaccaaggtt tcggttgggg agtttgtggg ggaaggtgaa gggaaaagca agaagatttc aaagaaaaat gccgccatag ctgttcttga ggagctgaag aagttaccgc ccctgcctgc agttgaacga gtaaagccta gaatcaaaaa gaaaacaaaa cccatagtca agccacagac aagcccagaa tatggccagg ggatcaatcc gattagccga ctggcccaga tccagcaggc aaaaaaggag aaggagccag agtacacgct cctcacagag cgaggcctcc cgcgccgcag ggagtttgtg atgcaggtga aggttggaaa ccacactgca gaaggaacgg gcaccaacaa gaaggtggcc aagcgcaatg cagccgagaa catgctggag atccttggtt tcaaagtccc gcaggcgcag cccaccaaac ccgcactcaa gtcagaggag aagacaccca taaagaaacc aggggatgga agaaaagtaa ccttttttga acctggctct ggggatgaaa atgggactag taataaagag gatgagttca ggatgcctta tctaagtcat cagcagctgc ctgctggaat tcttcccatg gtgcccgagg tcgcccaggc tgtaggagtt agtcaaggac atcacaccaa agattttacc agggcagctc cgaatcctgc caaggccacg gtaactgcca tgatagcccg agagttgttg tatgggggca cctcgcccac agccgagacc attttaaaga ataacatctc ttcaggccac gtaccccatg gacctctcac gagaccctct gagcaactgg actatctttc cagagtccag ggattccagg ttgaatacaa agacttcccc aaaaacaaca agaacgaatt tgtatctctt atcaattgct cctctcagcc acctctgatc agccatggta tcggcaagga tgtggagtcc tgccatgata tggctgcgct gaacatctta aagttgctgt ctgagttgga ccaacaaagt acagagatgc caagaacagg aaacggacca atgtctgtgt gtgggaggtg ctga. It is sometimes possible for the material contained within the vial of "STAU1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.