Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LCP1 cdna clone

LCP1 cDNA Clone

Gene Names
LCP1; LPL; CP64; PLS2; LC64P; HEL-S-37; L-PLASTIN
Synonyms
LCP1; LCP1 cDNA Clone; LCP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccagaggatcagtgtccgatgaggaaatgatggagctcagagaagcttttgccaaagttgatactgatggcaatggatacatcagcttcaatgagttgaatgacttgttcaaggctgcttgcttgcctttgcctgggtatagagtacgagaaattacagaaaacctgatggctacaggtgatctggaccaagatggaaggatcagctttgatgagtttatcaagattttccatggcctaaaaagcacagatgttgccaagacctttagaaaagcaatcaataagaaggaagggatttgtgcaatcggtggtacttcagagcagtctagcgttggcacccaacactcctattcagaggaagaaaagtatgcctttgtcaactggataaacaaagccctggaaaatgatcctgattgtcggcatgtcatcccaatgaacccaaacacgaatgatctctttaatgctgttggagatggcattgtcctttgtaaaatgatcaacctgtcagtgccagacacaattgatgaaagaacaatcaacaaaaagaagctaacccctttcaccattcaggaaaatctgaacttggctctgaactctgcctcagccatcgggtgccatgtggtcaacataggggctgaggacctgaaggaggggaagccttatctggtcctgggacttctgtggcaagtcatcaagattgggttgtttgctgacattgaactcagcagaaatgaagctctgattgctcttttgagagaaggtgagagcctggaggatttgatgaaactctcccctgaagagctcttgctgaggtgggctaattaccacctggaaaatgcaggctgcaacaaaattggcaacttcagtactgacatcaaggactcaaaagcttattaccacctgcttgagcaggtggctccaaaaggagatgaagaaggtgttcctgctgttgttattgacatgtcaggactgcgggagaaggatgacatccagagggcagaatgcatgctgcagcaggcggagaggctgggctgccggcagtttgtcacagccacagatgttgtccgagggaaccccaagttgaacttggcttttattgccaacctctttaacagataccctgccctgcacaaaccagagaaccaggacattgactggggggctcttgaaggtgagacgagagaagagcggacatttaggaactggatgaactccctgggtgttaaccctcgagtcaatcatttgtacagtgacttatcagatgccctggtcatcttccagctctatgaaaagatcaaagttcctgttgactggaacagagtaaacaaaccgccataccccaaactgggaggcaatatgaagaagcttgagaattgtaactacgcggtagaattggggaagaatcaagcgaagttctccctggttggcatcggtggacaagatctcaatgaaggaaaccgcactctcacactggccttgatttggcagctaatgagaaggtatacactgaatatcctcgaagaaattggtggtggccagaaggtcaatgatgacattattgtcaactgggtgaatgaaacattgagggaagcagagaaaagttcatccatctctagtttcaaggacccgaagattagtacaagtctgcctgttctggacctcatcgatgccatccaaccaggttccattaactatgaccttctgaagacagaaaatctgaatgatgatgagaaactcaacaatgcaaaatatgccatctctatggcccgaaaaattggagcaagagtgtatgccctgccagaagacctggttgaagtgaaccccaaaatggtcatgaccgtgtttgcctgcctcatggggaaaggaatgaagagggtgtga
Sequence Length
1884
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,792 Da
NCBI Official Full Name
Homo sapiens lymphocyte cytosolic protein 1 (L-plastin), mRNA
NCBI Official Synonym Full Names
lymphocyte cytosolic protein 1
NCBI Official Symbol
LCP1
NCBI Official Synonym Symbols
LPL; CP64; PLS2; LC64P; HEL-S-37; L-PLASTIN
NCBI Protein Information
plastin-2
UniProt Protein Name
Plastin-2
Protein Family
UniProt Gene Name
LCP1
UniProt Synonym Gene Names
PLS2; LCP-1
UniProt Entry Name
PLSL_HUMAN

NCBI Description

Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]

Uniprot Description

L-plastin: Actin-binding protein. Plays a role in the activation of T-cells in response to costimulation through TCR/CD3 and CD2 or CD28. Modulates the cell surface expression of IL2RA/CD25 and CD69. Monomer. Interacts with AIF1. Detected in intestinal microvilli, hair cell stereocilia, and fibroblast filopodia, in spleen and other lymph node-containing organs. Expressed in peripheral blood T- lymphocytes, neutrophils, monocytes, B-lymphocytes, and myeloid cells.

Protein type: Motility/polarity/chemotaxis; Actin-binding

Chromosomal Location of Human Ortholog: 13q14.3

Cellular Component: actin cytoskeleton; actin filament; actin filament bundle; cytoplasm; cytosol; extracellular space; filopodium; focal adhesion; plasma membrane; podosome; ruffle; stress fiber

Molecular Function: actin filament binding; GTPase binding

Biological Process: actin filament bundle formation; cell migration; extracellular matrix disassembly; regulation of intracellular protein transport; T cell activation during immune response

Research Articles on LCP1

Similar Products

Product Notes

The LCP1 lcp1 (Catalog #AAA1274140) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagag gatcagtgtc cgatgaggaa atgatggagc tcagagaagc ttttgccaaa gttgatactg atggcaatgg atacatcagc ttcaatgagt tgaatgactt gttcaaggct gcttgcttgc ctttgcctgg gtatagagta cgagaaatta cagaaaacct gatggctaca ggtgatctgg accaagatgg aaggatcagc tttgatgagt ttatcaagat tttccatggc ctaaaaagca cagatgttgc caagaccttt agaaaagcaa tcaataagaa ggaagggatt tgtgcaatcg gtggtacttc agagcagtct agcgttggca cccaacactc ctattcagag gaagaaaagt atgcctttgt caactggata aacaaagccc tggaaaatga tcctgattgt cggcatgtca tcccaatgaa cccaaacacg aatgatctct ttaatgctgt tggagatggc attgtccttt gtaaaatgat caacctgtca gtgccagaca caattgatga aagaacaatc aacaaaaaga agctaacccc tttcaccatt caggaaaatc tgaacttggc tctgaactct gcctcagcca tcgggtgcca tgtggtcaac ataggggctg aggacctgaa ggaggggaag ccttatctgg tcctgggact tctgtggcaa gtcatcaaga ttgggttgtt tgctgacatt gaactcagca gaaatgaagc tctgattgct cttttgagag aaggtgagag cctggaggat ttgatgaaac tctcccctga agagctcttg ctgaggtggg ctaattacca cctggaaaat gcaggctgca acaaaattgg caacttcagt actgacatca aggactcaaa agcttattac cacctgcttg agcaggtggc tccaaaagga gatgaagaag gtgttcctgc tgttgttatt gacatgtcag gactgcggga gaaggatgac atccagaggg cagaatgcat gctgcagcag gcggagaggc tgggctgccg gcagtttgtc acagccacag atgttgtccg agggaacccc aagttgaact tggcttttat tgccaacctc tttaacagat accctgccct gcacaaacca gagaaccagg acattgactg gggggctctt gaaggtgaga cgagagaaga gcggacattt aggaactgga tgaactccct gggtgttaac cctcgagtca atcatttgta cagtgactta tcagatgccc tggtcatctt ccagctctat gaaaagatca aagttcctgt tgactggaac agagtaaaca aaccgccata ccccaaactg ggaggcaata tgaagaagct tgagaattgt aactacgcgg tagaattggg gaagaatcaa gcgaagttct ccctggttgg catcggtgga caagatctca atgaaggaaa ccgcactctc acactggcct tgatttggca gctaatgaga aggtatacac tgaatatcct cgaagaaatt ggtggtggcc agaaggtcaa tgatgacatt attgtcaact gggtgaatga aacattgagg gaagcagaga aaagttcatc catctctagt ttcaaggacc cgaagattag tacaagtctg cctgttctgg acctcatcga tgccatccaa ccaggttcca ttaactatga ccttctgaag acagaaaatc tgaatgatga tgagaaactc aacaatgcaa aatatgccat ctctatggcc cgaaaaattg gagcaagagt gtatgccctg ccagaagacc tggttgaagt gaaccccaaa atggtcatga ccgtgtttgc ctgcctcatg gggaaaggaa tgaagagggt gtga. It is sometimes possible for the material contained within the vial of "LCP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.