Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPWD1 cdna clone

PPWD1 cDNA Clone

Synonyms
PPWD1; PPWD1 cDNA Clone; PPWD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggaaagtggtagcgattttcagcagagacgtagaaggcgccgggacccggaggaaccggaaaaaacagaactcagcgaaagagagctggcagtagcagtggcggtgtcccaggagaacgatgaggagaacgaagagcgctgggttggacctttacctgtggaggcaacactggccaagaagaggaaagtcttagagtttgaaagagtctatcttgataatctccccagtgcatccatgtatgagcgcagttacatgcatagagatgttatcacccatgtggtatgcaccaaaacagattttattattactgccagtcatgatggacatgtcaagttctggaaaaaaatagaagagggaattgaatttgttaaacattttcgtagtcacctgggagttattgagagtattgcagttagctctgagggagcattgttctgttctgtgggtgatgataaagcaatgaaggtgtttgatgtagtgaactttgacatgatcaacatgctgaaacttggctattttcctggacagtgtgagtggatctattgcccaggggatgcaatttcttcagttgctgcttccgaaaagagtacaggaaaaattttcatttatgatggccgaggagataaccagccacttcatatttttgacaaactccatacatcacctcttactcagatacggctaaacccagtttacaaagcagtagtgtcttctgacaaatctgggatgattgaatactggactgggcctcctcatgaatataaattccccaaaaatgtgaactgggaatataaaactgacactgatttatatgaatttgccaagtgtaaggcttatccaaccagcgtatgtttttcaccagatgggaagaaaatagctactattggttctgatagaaaagttagaattttcagatttgtaactggaaaactcatgagagtctttgatgaatcactaagcatgtttactgaactgcaacagatgaggcaacagttaccagacatggaatttggccgacgaatggctgtagaacgtgagttggagaaggttgatgctgtaagattaattaatatagtttttgatgaaactggacacttcgtgctgtatggaacaatgctgggcattaaagttataaatgtagagacaaaccggtgtgtgcggattttaggcaaacaagaaaatattagagtgatgcaattggctttgttccaggggatagccaaaaagcatcgtgctgcaactactatagaaatgaaagcttctgaaaatcctgttcttcagaatattcaagctgacccaacaatagtctgtacatcattcaaaaagaatagattttatatgtttaccaaacgagaaccagaagatacgaaaagtgcagattctgatcgagatgtttttaatgagaaaccttctaaagaagaagtcatggcagctactcaagctgaaggacctaaacgagtttcggacagtgccattatccacaccagcatgggagacattcacaccaaactttttcctgttgagtgccctaagacagtggaaaacttctgtgttcacagcagaaatggttattataatgggcatacatttcaccgtataattaagggctttatgattcagactggagatccaacaggtactggtatgggaggagaaagcatatggggaggagaatttgaagatgaatttcattcaacattacgacatgacaggccgtacacactcagcatggctaacgcgggatcaaatactaatggatcccagtttttcataacggtagtaccaacgccttggcttgataataagcatacagtatttggacgagtgactaaaggaatggaagttgtacagaggatctccaacgtcaaagtcaatcccaaaacagataagccctatgaggatgtcagcatcataaatattactgtcaagtaa
Sequence Length
1941
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,700 Da
NCBI Official Full Name
Homo sapiens peptidylprolyl isomerase domain and WD repeat containing 1, mRNA
NCBI Official Synonym Full Names
peptidylprolyl isomerase domain and WD repeat containing 1
NCBI Official Symbol
PPWD1
NCBI Protein Information
peptidylprolyl isomerase domain and WD repeat-containing protein 1
UniProt Protein Name
Peptidylprolyl isomerase domain and WD repeat-containing protein 1
UniProt Gene Name
PPWD1
UniProt Synonym Gene Names
KIAA0073
UniProt Entry Name
PPWD1_HUMAN

Uniprot Description

PPWD1: Putative peptidylprolyl isomerase (PPIase). PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. May be involved in pre-mRNA splicing. Belongs to the cyclophilin-type PPIase family. PPIL1 subfamily.

Protein type: Isomerase; RNA splicing; Spliceosome; EC 5.2.1.8

Chromosomal Location of Human Ortholog: 5q12.3

Cellular Component: nucleus

Molecular Function: peptidyl-prolyl cis-trans isomerase activity

Biological Process: nuclear mRNA splicing, via spliceosome

Research Articles on PPWD1

Similar Products

Product Notes

The PPWD1 ppwd1 (Catalog #AAA1274104) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg aaagtggtag cgattttcag cagagacgta gaaggcgccg ggacccggag gaaccggaaa aaacagaact cagcgaaaga gagctggcag tagcagtggc ggtgtcccag gagaacgatg aggagaacga agagcgctgg gttggacctt tacctgtgga ggcaacactg gccaagaaga ggaaagtctt agagtttgaa agagtctatc ttgataatct ccccagtgca tccatgtatg agcgcagtta catgcataga gatgttatca cccatgtggt atgcaccaaa acagatttta ttattactgc cagtcatgat ggacatgtca agttctggaa aaaaatagaa gagggaattg aatttgttaa acattttcgt agtcacctgg gagttattga gagtattgca gttagctctg agggagcatt gttctgttct gtgggtgatg ataaagcaat gaaggtgttt gatgtagtga actttgacat gatcaacatg ctgaaacttg gctattttcc tggacagtgt gagtggatct attgcccagg ggatgcaatt tcttcagttg ctgcttccga aaagagtaca ggaaaaattt tcatttatga tggccgagga gataaccagc cacttcatat ttttgacaaa ctccatacat cacctcttac tcagatacgg ctaaacccag tttacaaagc agtagtgtct tctgacaaat ctgggatgat tgaatactgg actgggcctc ctcatgaata taaattcccc aaaaatgtga actgggaata taaaactgac actgatttat atgaatttgc caagtgtaag gcttatccaa ccagcgtatg tttttcacca gatgggaaga aaatagctac tattggttct gatagaaaag ttagaatttt cagatttgta actggaaaac tcatgagagt ctttgatgaa tcactaagca tgtttactga actgcaacag atgaggcaac agttaccaga catggaattt ggccgacgaa tggctgtaga acgtgagttg gagaaggttg atgctgtaag attaattaat atagtttttg atgaaactgg acacttcgtg ctgtatggaa caatgctggg cattaaagtt ataaatgtag agacaaaccg gtgtgtgcgg attttaggca aacaagaaaa tattagagtg atgcaattgg ctttgttcca ggggatagcc aaaaagcatc gtgctgcaac tactatagaa atgaaagctt ctgaaaatcc tgttcttcag aatattcaag ctgacccaac aatagtctgt acatcattca aaaagaatag attttatatg tttaccaaac gagaaccaga agatacgaaa agtgcagatt ctgatcgaga tgtttttaat gagaaacctt ctaaagaaga agtcatggca gctactcaag ctgaaggacc taaacgagtt tcggacagtg ccattatcca caccagcatg ggagacattc acaccaaact ttttcctgtt gagtgcccta agacagtgga aaacttctgt gttcacagca gaaatggtta ttataatggg catacatttc accgtataat taagggcttt atgattcaga ctggagatcc aacaggtact ggtatgggag gagaaagcat atggggagga gaatttgaag atgaatttca ttcaacatta cgacatgaca ggccgtacac actcagcatg gctaacgcgg gatcaaatac taatggatcc cagtttttca taacggtagt accaacgcct tggcttgata ataagcatac agtatttgga cgagtgacta aaggaatgga agttgtacag aggatctcca acgtcaaagt caatcccaaa acagataagc cctatgagga tgtcagcatc ataaatatta ctgtcaagta a. It is sometimes possible for the material contained within the vial of "PPWD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.