Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PARP6 cdna clone

PARP6 cDNA Clone

Gene Names
PARP6; ARTD17; pART17; PARP-6-C; PARP-6-B1
Synonyms
PARP6; PARP6 cDNA Clone; PARP6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttacatcccaacaatggaaacatctgagcaatgatttcttgaagacccagcaggagaagaggcacagttggttcaaggcaagtggtaccatcaagaagttccgagctggcctcagcatcttttcacccatccccaagtctcccagtttccctatcatacaggactccatgctgaaaggcaaactaggtgtaccagagcttcgggttgggcgcctcatgaaccgttccatctcctgtaccatgaagaaccccaaagtggaagtgtttggctaccctcccagcccccaggtcagtggtcactgcaagaacattcccactctggagtatggattcctcgttcagatcatgaagtatgcagaacagaggattccaacattgaatgagtactgtgtggtgtgtgatgagcagcatgtcttccaaaatggatctatgctgaagccagctgtctgtactcgtgaactatgcgttttctccttctacacactgggcgtcatgtctggagctgcagaggaggtggccactggagcagaggtggtggatctgctggtggccatgtgtagggcagctttagagtcccctagaaagagcatcatctttgagccttatccctctgtggtggaccccactgatcccaagactctggcctttaaccctaagaagaagaattatgagcggcttcagaaagctctggatagtgtgatgtctattcgggagatgacccagggctcatatttggaaatcaagaaacagatggacaagttggatcccctggcccatcctctcctgcagtggatcatctctagcaacaggtcacacattgtcaaactacctctcagcaggctgaagttcatgcacacctcacaccagttcctcctgctgagcagccctcctgccaaggaggctcggttccggaccgccaagaagctctatggcagcacctttgccttccatgggtcccacattgagaactggcattcgatcctgcgcaatgggctggtcaatgcatcctacaccaaactgcaggaatgggaaaaggacagcacaggatgccctccaaggatgagctggtccagagatacaacaggatga
Sequence Length
1092
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,328 Da
NCBI Official Full Name
Homo sapiens poly (ADP-ribose) polymerase family, member 6, mRNA
NCBI Official Synonym Full Names
poly(ADP-ribose) polymerase family member 6
NCBI Official Symbol
PARP6
NCBI Official Synonym Symbols
ARTD17; pART17; PARP-6-C; PARP-6-B1
NCBI Protein Information
poly [ADP-ribose] polymerase 6
UniProt Protein Name
Poly [ADP-ribose] polymerase 6
UniProt Gene Name
PARP6
UniProt Synonym Gene Names
PARP-6; ARTD17
UniProt Entry Name
PARP6_HUMAN

Uniprot Description

PARP6: 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transferase; EC 2.4.2.30

Chromosomal Location of Human Ortholog: 15q23

Research Articles on PARP6

Similar Products

Product Notes

The PARP6 parp6 (Catalog #AAA1274027) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttacat cccaacaatg gaaacatctg agcaatgatt tcttgaagac ccagcaggag aagaggcaca gttggttcaa ggcaagtggt accatcaaga agttccgagc tggcctcagc atcttttcac ccatccccaa gtctcccagt ttccctatca tacaggactc catgctgaaa ggcaaactag gtgtaccaga gcttcgggtt gggcgcctca tgaaccgttc catctcctgt accatgaaga accccaaagt ggaagtgttt ggctaccctc ccagccccca ggtcagtggt cactgcaaga acattcccac tctggagtat ggattcctcg ttcagatcat gaagtatgca gaacagagga ttccaacatt gaatgagtac tgtgtggtgt gtgatgagca gcatgtcttc caaaatggat ctatgctgaa gccagctgtc tgtactcgtg aactatgcgt tttctccttc tacacactgg gcgtcatgtc tggagctgca gaggaggtgg ccactggagc agaggtggtg gatctgctgg tggccatgtg tagggcagct ttagagtccc ctagaaagag catcatcttt gagccttatc cctctgtggt ggaccccact gatcccaaga ctctggcctt taaccctaag aagaagaatt atgagcggct tcagaaagct ctggatagtg tgatgtctat tcgggagatg acccagggct catatttgga aatcaagaaa cagatggaca agttggatcc cctggcccat cctctcctgc agtggatcat ctctagcaac aggtcacaca ttgtcaaact acctctcagc aggctgaagt tcatgcacac ctcacaccag ttcctcctgc tgagcagccc tcctgccaag gaggctcggt tccggaccgc caagaagctc tatggcagca cctttgcctt ccatgggtcc cacattgaga actggcattc gatcctgcgc aatgggctgg tcaatgcatc ctacaccaaa ctgcaggaat gggaaaagga cagcacagga tgccctccaa ggatgagctg gtccagagat acaacaggat ga. It is sometimes possible for the material contained within the vial of "PARP6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.