ANKRD44 cdna clone
ANKRD44 cDNA Clone
Gene Names
ANKRD44; PP6-ARS-B
Synonyms
ANKRD44; ANKRD44 cDNA Clone; ANKRD44 cdna clone
Sequence
atggcagtgctcaaactcaccgaccagccaccattggttcaggcaatcttcagcggtgatccagaggagatccggatgctcatccataaaactgaagatgtgaatactctggattctgagaaacgaacccctcttcatgtggccgcatttctgggagatgcagagatcattgaactcctgattttgtcaggagctcgtgtaaatgccaaggacaacatgtggctgactccactgcaccgggctgttgcttccagaagtgaagaagcagtacaggttttgattaagcactcagctgatgtcaatgcaagggacaagaactggcagacccctcttcatgtggcagcagccaacaaggctgtcaaatgtgcagaagtgatcattcccctgctgagcagtgtcaatgtctccgaccgaggggggcgcacagccttgcaccatgcggctctgaacggccacgtggagatggtcaatttactcttggccaaaggggcaaatatcaatgcatttgacaagaaggaccggcgtgctctgcactgggcagcatacatgggccacttggatgttgtagcattgctcattaaccatggcgcagaagtgacctgtaaggataagaagggttatacccctctgcatgctgcagcctccaatggacagattaatgttgtcaagcatctcctgaacctgggggtggagattgatgaaatcaatgtctatggaaatacagcgcttcacatcgcctgctacaatggacaggatgctgtggttaacgagttgattgactacggtgctaacgtgaaccagccaaacaataatgggttcacccctttgcattttgctgctgcctccactcatggtgctttgtgtcttgaattgttagtaaacaacggggcagatgttaacattcagagtaaagatggcaaaagtccactgcacatgacagctgtccatggaaggttcacacggtcacagaccctcattcagaatggaggtgaaattgactgtgtggataaggacggcaacactcctctccatgtggctgcaagatacggtcatgagcttttgattaacaccttaataaccagcggagctgacacagccaagtag
Sequence Length
1104
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,601 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat domain 44, mRNA
NCBI Official Synonym Full Names
ankyrin repeat domain 44
NCBI Official Symbol
ANKRD44
NCBI Official Synonym Symbols
PP6-ARS-B
NCBI Protein Information
serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit B
UniProt Protein Name
Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit B
Protein Family
UniProt Gene Name
ANKRD44
UniProt Synonym Gene Names
PP6-ARS-B; Serine/threonine-protein phosphatase 6 regulatory subunit ARS-B
UniProt Entry Name
ANR44_HUMAN
Uniprot Description
ANKRD44: Putative regulatory subunit of protein phosphatase 6 (PP6) that may be involved in the recognition of phosphoprotein substrates. 5 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 2q33.1
Molecular Function: protein binding
Research Articles on ANKRD44
Similar Products
Product Notes
The ANKRD44 ankrd44 (Catalog #AAA1274021) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagtgc tcaaactcac cgaccagcca ccattggttc aggcaatctt cagcggtgat ccagaggaga tccggatgct catccataaa actgaagatg tgaatactct ggattctgag aaacgaaccc ctcttcatgt ggccgcattt ctgggagatg cagagatcat tgaactcctg attttgtcag gagctcgtgt aaatgccaag gacaacatgt ggctgactcc actgcaccgg gctgttgctt ccagaagtga agaagcagta caggttttga ttaagcactc agctgatgtc aatgcaaggg acaagaactg gcagacccct cttcatgtgg cagcagccaa caaggctgtc aaatgtgcag aagtgatcat tcccctgctg agcagtgtca atgtctccga ccgagggggg cgcacagcct tgcaccatgc ggctctgaac ggccacgtgg agatggtcaa tttactcttg gccaaagggg caaatatcaa tgcatttgac aagaaggacc ggcgtgctct gcactgggca gcatacatgg gccacttgga tgttgtagca ttgctcatta accatggcgc agaagtgacc tgtaaggata agaagggtta tacccctctg catgctgcag cctccaatgg acagattaat gttgtcaagc atctcctgaa cctgggggtg gagattgatg aaatcaatgt ctatggaaat acagcgcttc acatcgcctg ctacaatgga caggatgctg tggttaacga gttgattgac tacggtgcta acgtgaacca gccaaacaat aatgggttca cccctttgca ttttgctgct gcctccactc atggtgcttt gtgtcttgaa ttgttagtaa acaacggggc agatgttaac attcagagta aagatggcaa aagtccactg cacatgacag ctgtccatgg aaggttcaca cggtcacaga ccctcattca gaatggaggt gaaattgact gtgtggataa ggacggcaac actcctctcc atgtggctgc aagatacggt catgagcttt tgattaacac cttaataacc agcggagctg acacagccaa gtag. It is sometimes possible for the material contained within the vial of "ANKRD44, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
