Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VPS29 cdna clone

VPS29 cDNA Clone

Gene Names
VPS29; DC7; DC15; PEP11
Synonyms
VPS29; VPS29 cDNA Clone; VPS29 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgggcacagattggtgttggtattaggagatctgcacatcccacaccggtgcaacagtttgccagctaaattcaaaaaactcctggtgccaggaaaaattcagcacattctctgcacaggaaacctttgcaccaaagagagttatgactatctcaagactctggctggtgatgttcatattgtgagaggagacttcgatgagaatctgaattatccagaacagaaagttgtgactgttggacagttcaaaattggtctgatccatggacatcaagttattccatggggagatatggccagcttagccctgttgcagaggcaatttgatgtggacattcttatctcgggacacacacacaaatttgaagcatttgagcatgaaaataaattctacattaatccaggttctgccactggggcatataatgccttggaaacaaacattattccatcatttgtgttgatggatatccaggcttctacagtggtcacctatgtgtatcagctaattggagatgatgtgaaagtagaacgaatcgaatacaaaaaaccttaa
Sequence Length
561
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,927 Da
NCBI Official Full Name
Homo sapiens vacuolar protein sorting 29 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
VPS29, retromer complex component
NCBI Official Symbol
VPS29
NCBI Official Synonym Symbols
DC7; DC15; PEP11
NCBI Protein Information
vacuolar protein sorting-associated protein 29
UniProt Protein Name
Vacuolar protein sorting-associated protein 29
UniProt Gene Name
VPS29
UniProt Synonym Gene Names
hVPS29
UniProt Entry Name
VPS29_HUMAN

NCBI Description

This gene belongs to a group of vacuolar protein sorting (VPS) genes that, when functionally impaired, disrupt the efficient delivery of vacuolar hydrolases. The protein encoded by this gene is a component of a large multimeric complex, termed the retromer complex, which is involved in retrograde transport of proteins from endosomes to the trans-Golgi network. This VPS protein may be involved in the formation of the inner shell of the retromer coat for retrograde vesicles leaving the prevacuolar compartment. Alternative splice variants encoding different isoforms and representing non-protein coding transcripts have been found for this gene. [provided by RefSeq, Aug 2013]

Uniprot Description

VPS29: Essential component of the retromer complex, a complex required to retrieve lysosomal enzyme receptors (IGF2R and M6PR) from endosomes to the trans-Golgi network. Also required to regulate transcytosis of the polymeric immunoglobulin receptor (pIgR-pIgA). Has low protein phosphatase activity towards a serine-phosphorylated peptide derived from IGF2R (in vitro). Belongs to the VPS29 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.1.3.3; Vesicle; Protein phosphatase, Ser/Thr (non-receptor)

Chromosomal Location of Human Ortholog: 12q24

Cellular Component: cytoplasm; cytosol; endosome; intracellular membrane-bound organelle; retromer complex

Molecular Function: protein binding; protein transporter activity

Biological Process: intracellular protein transport; retrograde transport, endosome to Golgi; Wnt receptor signaling pathway

Research Articles on VPS29

Similar Products

Product Notes

The VPS29 vps29 (Catalog #AAA1273984) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgggc acagattggt gttggtatta ggagatctgc acatcccaca ccggtgcaac agtttgccag ctaaattcaa aaaactcctg gtgccaggaa aaattcagca cattctctgc acaggaaacc tttgcaccaa agagagttat gactatctca agactctggc tggtgatgtt catattgtga gaggagactt cgatgagaat ctgaattatc cagaacagaa agttgtgact gttggacagt tcaaaattgg tctgatccat ggacatcaag ttattccatg gggagatatg gccagcttag ccctgttgca gaggcaattt gatgtggaca ttcttatctc gggacacaca cacaaatttg aagcatttga gcatgaaaat aaattctaca ttaatccagg ttctgccact ggggcatata atgccttgga aacaaacatt attccatcat ttgtgttgat ggatatccag gcttctacag tggtcaccta tgtgtatcag ctaattggag atgatgtgaa agtagaacga atcgaataca aaaaacctta a. It is sometimes possible for the material contained within the vial of "VPS29, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.