GLIS3 cdna clone
GLIS3 cDNA Clone
Gene Names
GLIS3; NDH; ZNF515
Synonyms
GLIS3; GLIS3 cDNA Clone; GLIS3 cdna clone
Sequence
atgatggttcagcgactgggactcatttcacctccagcaagccaggtctctacagcatgcaaccagatcagtcctagcttacagagggcaatgaatgcagccaacctgaatatacctccttcagataccaggtcccttatttcgcgtgagtctttggcgtccacgaccttgagtctgacggaaagtcagtcggcctcaagcatgaagcaggagtggtcccagggctacagggccctcccttcgctctccaaccacggctctcagaatggccttgatctaggggatctccttagccttcctcccgggacatccatgtccagcaatagtgtctctaactcattaccatcctacctttttggcacggaaagtagccactctccttaccctagtcctcggcactcatccaccaggtcccactcggcccgctccaagaagagagcgctgtccttgtccccgctgtccgatggcatcgggatagatttcaataccatcatccgcacgtcgcccacgtccttggtggcctacatcaacgggtcgagggcttcgccggccaacctgtccccgcagccggaggtctacgggcatttcctgggcgtgcgcggcagctgcattccccagccgcgcccggtgcccggcagccagaagggcgtgctggtggcccctggaggcctggcgctgccggcctacggcgaggacggggccctggagcacgagcgcatgcaacagctggagcacggcggcctgcagccaggcctggtcaaccacatggtggtgcagcatggcctgccgggccccgacagccagccggccggcctgttcaagaccgaacgcctggaggagttcccgggcagcaccgtagacctaccccccgcgcctccgctccctcctctgccgccgccccaaggccccccacccccttaccatgcccatgcgcaccttcaccacccggagctcgggccccacgcccagcagctggccttgccccaggccaccctggacgacgacggggagatggacggcatcgggggcaagcattgctaccgctggatcgactgcagcgccctgtacgaccagcaggaggagctcgtgcggcacatcgagaaggtccacatcgaccagcgcaaaggggaggacttcacttgcttctgggccggttgccctcgaagatacaagcccttcaacgcccgctataaactgctgatccacatgagagtccactctggggagaagcccaacaagtgtacgtttgaaggttgcgagaaggccttttcaaggcttgaaaatctcaagatccacttgcggagccacacaggcgagaagccgtatttgtgccagcatccgggttgtcagaaggccttcagtaactccagtgaccgcgccaaacaccagcggacgcatctggacaccaaaccttatgcttgtcaaattccaggatgtaccaaacgctacacagacccaagttccctaagaaagcatgtgaaggcacattcttccaaagagcaacaagcaaggaaaaagttgcggtccagcacagagctccatccagacctgctcacagattgcctcaccgtgcagtccctgcagccggccacttcccctagagatgctgctgctgaagggaccgtgggacgctcccctggacccgggcctgacctctattcagctcccattttctccagcaattattcaagccgaagtggaacagctgctggggccgtaccacccccacatcctgtcagtcacccttctccaggacataatgtacaggggagccctcacaacccctcctcccagttacctccactcacagctgtggacgcaggagctgagaggtttgcaccttctgctccatctcctcaccacatcagcccccggagagttccagctccttcttcaatactgcaaagaacacagcctccctatacccagcagccatcaggttcacacctgaagtcctatcagccagaaacaaactcttcttttcaaccaaatggtatccatgtccatggattttatgggcagctgcagaagttctgtcccccacactaccccgattcccagagaattgtgccgcctgtcagctcctgcagtgtggtgccttcgtttgaggactgcctagtccctacatccatgggccaggccagttttgatgttttccacagagccttctcgactcactcgggcattacagtgtatgatttaccttcaagttcctcgagcctctttggggagtctctccgcagcggggctgaagatgctaccttcttgcagatcagcaccgtggaccgctgtcctagccagctctcctctgtctacaccgaaggctaa
Sequence Length
2328
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
99,605 Da
NCBI Official Full Name
Homo sapiens GLIS family zinc finger 3, mRNA
NCBI Official Synonym Full Names
GLIS family zinc finger 3
NCBI Official Symbol
GLIS3
NCBI Official Synonym Symbols
NDH; ZNF515
NCBI Protein Information
zinc finger protein GLIS3
UniProt Protein Name
Zinc finger protein GLIS3
Protein Family
UniProt Gene Name
GLIS3
UniProt Synonym Gene Names
ZNF515
UniProt Entry Name
GLIS3_HUMAN
NCBI Description
This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear protein with five C2H2-type zinc finger domains. This protein functions as both a repressor and activator of transcription and is specifically involved in the development of pancreatic beta cells, the thyroid, eye, liver and kidney. Mutations in this gene have been associated with neonatal diabetes and congenital hypothyroidism (NDH). Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only two have been determined. [provided by RefSeq, Jul 2008]
Uniprot Description
GLIS3: Acts as both a repressor and activator of transcription. Binds to the consensus sequence 5'-GACCACCCAC-3'. Defects in GLIS3 are a cause of diabetes mellitus neonatal with congenital hypothyroidism (NDH). NDH is a neonatal diabetes syndrome associated with congenital hypothyroidism, congenital glaucoma, hepatic fibrosis and polycystic kidneys. Belongs to the GLI C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: C2H2-type zinc finger protein; Transcription factor
Chromosomal Location of Human Ortholog: 9p24.2
Cellular Component: Golgi apparatus; nucleoplasm; nucleus
Biological Process: negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter
Disease: Diabetes Mellitus, Neonatal, With Congenital Hypothyroidism
Research Articles on GLIS3
Similar Products
Product Notes
The GLIS3 glis3 (Catalog #AAA1273958) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggttc agcgactggg actcatttca cctccagcaa gccaggtctc tacagcatgc aaccagatca gtcctagctt acagagggca atgaatgcag ccaacctgaa tatacctcct tcagatacca ggtcccttat ttcgcgtgag tctttggcgt ccacgacctt gagtctgacg gaaagtcagt cggcctcaag catgaagcag gagtggtccc agggctacag ggccctccct tcgctctcca accacggctc tcagaatggc cttgatctag gggatctcct tagccttcct cccgggacat ccatgtccag caatagtgtc tctaactcat taccatccta cctttttggc acggaaagta gccactctcc ttaccctagt cctcggcact catccaccag gtcccactcg gcccgctcca agaagagagc gctgtccttg tccccgctgt ccgatggcat cgggatagat ttcaatacca tcatccgcac gtcgcccacg tccttggtgg cctacatcaa cgggtcgagg gcttcgccgg ccaacctgtc cccgcagccg gaggtctacg ggcatttcct gggcgtgcgc ggcagctgca ttccccagcc gcgcccggtg cccggcagcc agaagggcgt gctggtggcc cctggaggcc tggcgctgcc ggcctacggc gaggacgggg ccctggagca cgagcgcatg caacagctgg agcacggcgg cctgcagcca ggcctggtca accacatggt ggtgcagcat ggcctgccgg gccccgacag ccagccggcc ggcctgttca agaccgaacg cctggaggag ttcccgggca gcaccgtaga cctacccccc gcgcctccgc tccctcctct gccgccgccc caaggccccc caccccctta ccatgcccat gcgcaccttc accacccgga gctcgggccc cacgcccagc agctggcctt gccccaggcc accctggacg acgacgggga gatggacggc atcgggggca agcattgcta ccgctggatc gactgcagcg ccctgtacga ccagcaggag gagctcgtgc ggcacatcga gaaggtccac atcgaccagc gcaaagggga ggacttcact tgcttctggg ccggttgccc tcgaagatac aagcccttca acgcccgcta taaactgctg atccacatga gagtccactc tggggagaag cccaacaagt gtacgtttga aggttgcgag aaggcctttt caaggcttga aaatctcaag atccacttgc ggagccacac aggcgagaag ccgtatttgt gccagcatcc gggttgtcag aaggccttca gtaactccag tgaccgcgcc aaacaccagc ggacgcatct ggacaccaaa ccttatgctt gtcaaattcc aggatgtacc aaacgctaca cagacccaag ttccctaaga aagcatgtga aggcacattc ttccaaagag caacaagcaa ggaaaaagtt gcggtccagc acagagctcc atccagacct gctcacagat tgcctcaccg tgcagtccct gcagccggcc acttccccta gagatgctgc tgctgaaggg accgtgggac gctcccctgg acccgggcct gacctctatt cagctcccat tttctccagc aattattcaa gccgaagtgg aacagctgct ggggccgtac cacccccaca tcctgtcagt cacccttctc caggacataa tgtacagggg agccctcaca acccctcctc ccagttacct ccactcacag ctgtggacgc aggagctgag aggtttgcac cttctgctcc atctcctcac cacatcagcc cccggagagt tccagctcct tcttcaatac tgcaaagaac acagcctccc tatacccagc agccatcagg ttcacacctg aagtcctatc agccagaaac aaactcttct tttcaaccaa atggtatcca tgtccatgga ttttatgggc agctgcagaa gttctgtccc ccacactacc ccgattccca gagaattgtg ccgcctgtca gctcctgcag tgtggtgcct tcgtttgagg actgcctagt ccctacatcc atgggccagg ccagttttga tgttttccac agagccttct cgactcactc gggcattaca gtgtatgatt taccttcaag ttcctcgagc ctctttgggg agtctctccg cagcggggct gaagatgcta ccttcttgca gatcagcacc gtggaccgct gtcctagcca gctctcctct gtctacaccg aaggctaa. It is sometimes possible for the material contained within the vial of "GLIS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
