Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LSM7 cdna clone

LSM7 cDNA Clone

Gene Names
LSM7; YNL147W
Synonyms
LSM7; LSM7 cDNA Clone; LSM7 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggataaggagaagaagaaaaaggagagcatcttggacttgtccaagtacatcgacaagacgatccgggtaaagttccagggaggccgcgaagccagtggaatcctgaagggcttcgacccactcctcaaccttgtgctggacggcaccattgagtacatgcgagaccctgacgaccagtacaagctcacggaggacacccggcagctgggcctcgtggtgtgccggggcacgtccgtggtgctaatctgcccgcaggacggcatggaggccatccccaaccccttcatccagcagcaggacgcctag
Sequence Length
312
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,602 Da
NCBI Official Full Name
Homo sapiens LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
LSM7 homolog, U6 small nuclear RNA and mRNA degradation associated
NCBI Official Symbol
LSM7
NCBI Official Synonym Symbols
YNL147W
NCBI Protein Information
U6 snRNA-associated Sm-like protein LSm7
UniProt Protein Name
U6 snRNA-associated Sm-like protein LSm7
Protein Family
UniProt Gene Name
LSM7
UniProt Entry Name
LSM7_HUMAN

NCBI Description

Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]

Uniprot Description

LSM7: Binds specifically to the 3'-terminal U-tract of U6 snRNA. Belongs to the snRNP Sm proteins family.

Protein type: RNA splicing; Spliceosome

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cytosol; nucleoplasm; U12-dependent spliceosome

Molecular Function: protein binding; RNA binding

Biological Process: nuclear mRNA splicing, via spliceosome; RNA processing

Research Articles on LSM7

Similar Products

Product Notes

The LSM7 lsm7 (Catalog #AAA1273881) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggata aggagaagaa gaaaaaggag agcatcttgg acttgtccaa gtacatcgac aagacgatcc gggtaaagtt ccagggaggc cgcgaagcca gtggaatcct gaagggcttc gacccactcc tcaaccttgt gctggacggc accattgagt acatgcgaga ccctgacgac cagtacaagc tcacggagga cacccggcag ctgggcctcg tggtgtgccg gggcacgtcc gtggtgctaa tctgcccgca ggacggcatg gaggccatcc ccaacccctt catccagcag caggacgcct ag. It is sometimes possible for the material contained within the vial of "LSM7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.