SLC39A6 cdna clone
SLC39A6 cDNA Clone
Gene Names
SLC39A6; ZIP6; LIV-1
Synonyms
SLC39A6; SLC39A6 cDNA Clone; SLC39A6 cdna clone
Sequence
atgggcatccaggttccgctgaatgcaacagagttcaactatctctgtccagccatcatcaaccaaattgatgctagatcttgtctgattcatacaagtgaaaagaaggctgaaatccctccaaagacctattcattacaaatagcctgggttggtggttttatagccatttccatcatcagtttcctgtctctgctgggggttatcttagtgcctctcatgaatcgggtgtttttcaaatttctcctgagtttccttgtggcactggccgttgggactttgagtggtgatgcttttttacaccttcttccacattctcatgcaagtcaccaccatagtcatagccatgaagaaccagcaatggaaatgaaaagaggaccacttttcagtcatctgtcttctcaaaacatagaagaaagtgcctattttgattccacgtggaagggtctaacagctctaggaggcctgtatttcatgtttcttgttgaacatgtcctcacattgatcaaacaatttaaagataagaagaaaaagaatcagaagaaacctgaaaatgatgatgatgtggagattaagaagcagttgtccaagtatgaatctcaactttcaacaaatgaggagaaagtagatacagatgatcgaactgaaggctatttacgagcagactcacaagagccctcccactttgattctcagcagcctgcagtcttggaagaagaagaggtcatgatagctcatgctcatccacaggaagtctacaatgaatatgtacccagagggtgcaagaataaatgccattcacatttccacgatacactcggccagtcagacgatctcattcaccaccatcatgactaccatcatattctccatcatcaccaccaccaaaaccaccatcctcacagtcacagccagcgctactctcgggaggagctgaaagatgccggcgtcgccactctggcctggatggtgataatgggtgatggcctgcacaatttcagcgatggcctagcaattggtgctgcttttactgaaggcttatcaagtggtttaagtacttctgttgctgtgttctgtcatgagttgcctcatgaattaggtgactttgctgttctactaaaggctggcatgaccgttaagcaggctgtcctttataatgcattgtcagccatgctggcgtatcttggaatggcaacaggaattttcattggtcattatgctgaaaatgtttctatgtggatatttgcacttactgctggcttattcatgtatgttgctctggttgatatggtaagtttttaa
Sequence Length
1302
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,605 Da
NCBI Official Full Name
Homo sapiens solute carrier family 39 (zinc transporter), member 6, mRNA
NCBI Official Synonym Full Names
solute carrier family 39 member 6
NCBI Official Symbol
SLC39A6
NCBI Official Synonym Symbols
ZIP6; LIV-1
NCBI Protein Information
zinc transporter ZIP6
UniProt Protein Name
Zinc transporter ZIP6
Protein Family
UniProt Gene Name
SLC39A6
UniProt Synonym Gene Names
LIV1; ZIP6; ZIP-6
UniProt Entry Name
S39A6_HUMAN
NCBI Description
Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A6 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
Uniprot Description
SLC39A6: May act as a zinc-influx transporter. Belongs to the ZIP transporter (TC 2.A.5) family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass; Transporter, SLC family; Transporter
Chromosomal Location of Human Ortholog: 18q12.2
Cellular Component: cell surface; integral to plasma membrane; plasma membrane
Molecular Function: zinc ion transmembrane transporter activity
Biological Process: cellular zinc ion homeostasis
Research Articles on SLC39A6
Similar Products
Product Notes
The SLC39A6 slc39a6 (Catalog #AAA1273851) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcatcc aggttccgct gaatgcaaca gagttcaact atctctgtcc agccatcatc aaccaaattg atgctagatc ttgtctgatt catacaagtg aaaagaaggc tgaaatccct ccaaagacct attcattaca aatagcctgg gttggtggtt ttatagccat ttccatcatc agtttcctgt ctctgctggg ggttatctta gtgcctctca tgaatcgggt gtttttcaaa tttctcctga gtttccttgt ggcactggcc gttgggactt tgagtggtga tgctttttta caccttcttc cacattctca tgcaagtcac caccatagtc atagccatga agaaccagca atggaaatga aaagaggacc acttttcagt catctgtctt ctcaaaacat agaagaaagt gcctattttg attccacgtg gaagggtcta acagctctag gaggcctgta tttcatgttt cttgttgaac atgtcctcac attgatcaaa caatttaaag ataagaagaa aaagaatcag aagaaacctg aaaatgatga tgatgtggag attaagaagc agttgtccaa gtatgaatct caactttcaa caaatgagga gaaagtagat acagatgatc gaactgaagg ctatttacga gcagactcac aagagccctc ccactttgat tctcagcagc ctgcagtctt ggaagaagaa gaggtcatga tagctcatgc tcatccacag gaagtctaca atgaatatgt acccagaggg tgcaagaata aatgccattc acatttccac gatacactcg gccagtcaga cgatctcatt caccaccatc atgactacca tcatattctc catcatcacc accaccaaaa ccaccatcct cacagtcaca gccagcgcta ctctcgggag gagctgaaag atgccggcgt cgccactctg gcctggatgg tgataatggg tgatggcctg cacaatttca gcgatggcct agcaattggt gctgctttta ctgaaggctt atcaagtggt ttaagtactt ctgttgctgt gttctgtcat gagttgcctc atgaattagg tgactttgct gttctactaa aggctggcat gaccgttaag caggctgtcc tttataatgc attgtcagcc atgctggcgt atcttggaat ggcaacagga attttcattg gtcattatgc tgaaaatgtt tctatgtgga tatttgcact tactgctggc ttattcatgt atgttgctct ggttgatatg gtaagttttt aa. It is sometimes possible for the material contained within the vial of "SLC39A6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
