Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC20 cdna clone

CDC20 cDNA Clone

Gene Names
CDC20; CDC20A; p55CDC; bA276H19.3
Synonyms
CDC20; CDC20 cDNA Clone; CDC20 cdna clone
Ordering
For Research Use Only!
Sequence
atggcacagttcgcgttcgagagtgacctgcactcgctgcttcagctggatgcacccatccccaatgcaccccctgcgcgctggcagcgcaaagccaaggaagccgcaggcccggccccctcacccatgcgggccgccaaccgatcccacagcgccggcaggactccgggccgaactcctggcaaatccagttccaaggttcagaccactcctagcaaacctggcggtgaccgctatatcccccatcgcagtgctgcccagatggaggtggccagcttcctcctgagcaaggagaaccagcctgaaaacagccagacgcccaccaagaaggaacatcagaaagcctgggctttgaacctgaacggttttgatgtagaggaagccaagatccttcggctcagtggaaaaccacaaaatgcgccagagggttaccagaacagactgaaagtactctacagccaaaaggccactcctggctccagccggaagacctgccgttacattccttccctgccagaccgtatcctggatgcgcctgaaatccgaaatgactattacctgaaccttgtggattggagttctgggaatgtactggccgtggcactggacaacagtgtgtacctgtggagtgcaagctctggtgacatcctgcagcttttgcaaatggagcagcctggggaatatatatcctctgtggcctggatcaaagagggcaactacttggctgtgggcaccagcagtgctgaggtgcagctatgggatgtgcagcagcagaaacggcttcgaaatatgaccagtcactctgcccgagtgggctccctaagctggaacagctatatcctgtccagtggttcacgttctggccacatccaccaccatgatgttcgggtagcagaacaccatgtggccacactgagtggccacagccaggaagtgtgtgggctgcgctgggccccagatggacgacatttggccagtggtggtaatgataacttggtcaatgtgtggcctagtgctcctggagagggtggctgggttcctctgcagacattcacccagcatcaaggggctgtcaaggccgtagcatggtgtccctggcagtccaatgtcctggcaacaggagggggcaccagtgatcgacacattcgcatctggaatgtgtgctctggggcctgtctgagtgccgtggatgcccattcccaggtgtgctccatcctctggtctccccattacaaggagctcatctcaggccatggctttgcacagaaccagctagttatttggaagtacccaaccatggccaaggtggctgaactcaaaggtcacacatcccgggtcctgagtctgaccatgagcccagatggggccacagtggcatccgcagcagcagatgagaccctgaggctatggcgctgttttgagttggaccctgcgcggcggcgggagcgggagaaggccagtgcagccaaaagcagcctcatccaccaaggcatccgctga
Sequence Length
1500
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
991
Molecular Weight
54,723 Da
NCBI Official Full Name
Homo sapiens cell division cycle 20 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
cell division cycle 20
NCBI Official Symbol
CDC20
NCBI Official Synonym Symbols
CDC20A; p55CDC; bA276H19.3
NCBI Protein Information
cell division cycle protein 20 homolog
UniProt Protein Name
Cell division cycle protein 20 homolog
UniProt Gene Name
CDC20
UniProt Entry Name
CDC20_HUMAN

NCBI Description

CDC20 appears to act as a regulatory protein interacting with several other proteins at multiple points in the cell cycle. It is required for two microtubule-dependent processes, nuclear movement prior to anaphase and chromosome separation. [provided by RefSeq, Jul 2008]

Uniprot Description

CDC20: Required for full ubiquitin ligase activity of the anaphase promoting complex/cyclosome (APC/C) and may confer substrate specificity upon the complex. Is regulated by MAD2L1: in metaphase the MAD2L1-CDC20-APC/C ternary complex is inactive and in anaphase the CDC20-APC/C binary complex is active in degrading substrates. The CDC20-APC/C complex positively regulates the formation of synaptic vesicle clustering at active zone to the presynaptic membrane in postmitotic neurons. CDC20-APC/C-induced degradation of NEUROD2 induces presynaptic differentiation. Found in a complex with CDC20, CDC27, SPATC1 and TUBG1. Interacts with SPATC1. Interacts with NEUROD2. Interacts with MAD2L1 and BUB1B. The phosphorylated form interacts with APC/C. Interacts with NINL. May interact with MAD2L2. Interacts with CDK5RAP2. Interacts with isoform 1 of NEK2. Belongs to the WD repeat CDC20/Fizzy family.

Protein type: Ubiquitin conjugating system; Cell cycle regulation

Chromosomal Location of Human Ortholog: 1p34.1

Cellular Component: anaphase-promoting complex; cytoplasm; cytosol; nucleoplasm; nucleus; spindle

Molecular Function: enzyme binding; protein binding; protein C-terminus binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; cell cycle; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of synaptic plasticity; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of ubiquitin-protein ligase activity during mitotic cell cycle; sister chromatid cohesion

Research Articles on CDC20

Similar Products

Product Notes

The CDC20 cdc20 (Catalog #AAA1273776) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcacagt tcgcgttcga gagtgacctg cactcgctgc ttcagctgga tgcacccatc cccaatgcac cccctgcgcg ctggcagcgc aaagccaagg aagccgcagg cccggccccc tcacccatgc gggccgccaa ccgatcccac agcgccggca ggactccggg ccgaactcct ggcaaatcca gttccaaggt tcagaccact cctagcaaac ctggcggtga ccgctatatc ccccatcgca gtgctgccca gatggaggtg gccagcttcc tcctgagcaa ggagaaccag cctgaaaaca gccagacgcc caccaagaag gaacatcaga aagcctgggc tttgaacctg aacggttttg atgtagagga agccaagatc cttcggctca gtggaaaacc acaaaatgcg ccagagggtt accagaacag actgaaagta ctctacagcc aaaaggccac tcctggctcc agccggaaga cctgccgtta cattccttcc ctgccagacc gtatcctgga tgcgcctgaa atccgaaatg actattacct gaaccttgtg gattggagtt ctgggaatgt actggccgtg gcactggaca acagtgtgta cctgtggagt gcaagctctg gtgacatcct gcagcttttg caaatggagc agcctgggga atatatatcc tctgtggcct ggatcaaaga gggcaactac ttggctgtgg gcaccagcag tgctgaggtg cagctatggg atgtgcagca gcagaaacgg cttcgaaata tgaccagtca ctctgcccga gtgggctccc taagctggaa cagctatatc ctgtccagtg gttcacgttc tggccacatc caccaccatg atgttcgggt agcagaacac catgtggcca cactgagtgg ccacagccag gaagtgtgtg ggctgcgctg ggccccagat ggacgacatt tggccagtgg tggtaatgat aacttggtca atgtgtggcc tagtgctcct ggagagggtg gctgggttcc tctgcagaca ttcacccagc atcaaggggc tgtcaaggcc gtagcatggt gtccctggca gtccaatgtc ctggcaacag gagggggcac cagtgatcga cacattcgca tctggaatgt gtgctctggg gcctgtctga gtgccgtgga tgcccattcc caggtgtgct ccatcctctg gtctccccat tacaaggagc tcatctcagg ccatggcttt gcacagaacc agctagttat ttggaagtac ccaaccatgg ccaaggtggc tgaactcaaa ggtcacacat cccgggtcct gagtctgacc atgagcccag atggggccac agtggcatcc gcagcagcag atgagaccct gaggctatgg cgctgttttg agttggaccc tgcgcggcgg cgggagcggg agaaggccag tgcagccaaa agcagcctca tccaccaagg catccgctga. It is sometimes possible for the material contained within the vial of "CDC20, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.