Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJC18 cdna clone

DNAJC18 cDNA Clone

Synonyms
DNAJC18; DNAJC18 cDNA Clone; DNAJC18 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgactctgggcagcggggagcgctggacggaagcttacattgacgcagttagaagaaacaaatacccagaagacacacctcctgagagtcatgacccctgtggctgctgtaactgcatgaaggcacaaaaggaaaagaagtctgagaatgagtggactcagacccggcagggtgaggggaactccacgtacagtgaggaacagctgcttggggtacaaaggatcaagaaatgcagaaattactatgaaattctgggagtttctcgagatgctagtgacgaagagcttaagaaagcttacagaaaactcgccctgaaatttcaccctgacaagaactgtgctcctggagcaacagatgctttcaaagcaataggaaatgcatttgcagtcctgagcaatcctgataagagacttcgctatgatgaatacggagatgaacaggtgactttcactgcccctcgagccagaccttataattattacagggattttgaagctgacatcactccagaagagctgttcaacgtcttctttggaggacattttcctacaggaaatattcatatgttttcaaatgtgacagatgacacttactattaccgtcgacggcaccgacatgagaggacacagactcagaaggaggaggaagaagagaaacctcagactacatattctgcatttattcagctacttccagttcttgtgattgtgattatatctgtcattactcagctgctggctactaatcccccatatagtctgttctataaatcgaccttgggctacaccatttctagagaaactcagaacctgcaggtgccttactttgtggataaaaactttgacaaggcctacagaggagcttctctgcatgacttggagaaaacaatagagaaggattacattgattatatccagactagttgttggaaggagaaacaacaaaagtcagagctgacaaatttggcaggattatacagagatgaacgattgaaacagaaagcagagtcgctgaaacttgaaaactgtgagaaactttccaaactcattggcctacgcagaggtggctga
Sequence Length
1077
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,551 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 18, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member C18
NCBI Official Symbol
DNAJC18
NCBI Protein Information
dnaJ homolog subfamily C member 18
UniProt Protein Name
DnaJ homolog subfamily C member 18
Protein Family
UniProt Gene Name
DNAJC18
UniProt Entry Name
DJC18_HUMAN

Uniprot Description

DNAJC18:

Protein type: Membrane protein, integral; Chaperone

Chromosomal Location of Human Ortholog: 5q31.2

Research Articles on DNAJC18

Similar Products

Product Notes

The DNAJC18 dnajc18 (Catalog #AAA1273734) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcga ctctgggcag cggggagcgc tggacggaag cttacattga cgcagttaga agaaacaaat acccagaaga cacacctcct gagagtcatg acccctgtgg ctgctgtaac tgcatgaagg cacaaaagga aaagaagtct gagaatgagt ggactcagac ccggcagggt gaggggaact ccacgtacag tgaggaacag ctgcttgggg tacaaaggat caagaaatgc agaaattact atgaaattct gggagtttct cgagatgcta gtgacgaaga gcttaagaaa gcttacagaa aactcgccct gaaatttcac cctgacaaga actgtgctcc tggagcaaca gatgctttca aagcaatagg aaatgcattt gcagtcctga gcaatcctga taagagactt cgctatgatg aatacggaga tgaacaggtg actttcactg cccctcgagc cagaccttat aattattaca gggattttga agctgacatc actccagaag agctgttcaa cgtcttcttt ggaggacatt ttcctacagg aaatattcat atgttttcaa atgtgacaga tgacacttac tattaccgtc gacggcaccg acatgagagg acacagactc agaaggagga ggaagaagag aaacctcaga ctacatattc tgcatttatt cagctacttc cagttcttgt gattgtgatt atatctgtca ttactcagct gctggctact aatcccccat atagtctgtt ctataaatcg accttgggct acaccatttc tagagaaact cagaacctgc aggtgcctta ctttgtggat aaaaactttg acaaggccta cagaggagct tctctgcatg acttggagaa aacaatagag aaggattaca ttgattatat ccagactagt tgttggaagg agaaacaaca aaagtcagag ctgacaaatt tggcaggatt atacagagat gaacgattga aacagaaagc agagtcgctg aaacttgaaa actgtgagaa actttccaaa ctcattggcc tacgcagagg tggctga. It is sometimes possible for the material contained within the vial of "DNAJC18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.