Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PNPLA3 cdna clone

PNPLA3 cDNA Clone

Gene Names
PNPLA3; ADPN; C22orf20; iPLA(2)epsilon
Synonyms
PNPLA3; PNPLA3 cDNA Clone; PNPLA3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccgacgatgtcctgtggttgcagtgggtgacctcacaggtgttcactcgagtgctgatgtgtctgctccccgcctccaggtcccaaatgccagtgagcagccaacaggcctccccatgcacacctgagcaggactggccctgctggactccctgctcccccgagggctgtccagcagagaccaaagcagaggccaccccgcggtccatcctcaggtccagcctgaacttcttcttgggcaataaagtacctgctggtgctgaggggctctccacctttcccagtttttcactagagaagagtctgtga
Sequence Length
312
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,485 Da
NCBI Official Full Name
Homo sapiens patatin-like phospholipase domain containing 3, mRNA
NCBI Official Synonym Full Names
patatin like phospholipase domain containing 3
NCBI Official Symbol
PNPLA3
NCBI Official Synonym Symbols
ADPN; C22orf20; iPLA(2)epsilon
NCBI Protein Information
patatin-like phospholipase domain-containing protein 3
UniProt Protein Name
Patatin-like phospholipase domain-containing protein 3
UniProt Gene Name
PNPLA3
UniProt Synonym Gene Names
ADPN; C22orf20; iPLA2-epsilon
UniProt Entry Name
PLPL3_HUMAN

NCBI Description

The protein encoded by this gene is a triacylglycerol lipase that mediates triacylglycerol hydrolysis in adipocytes. The encoded protein, which appears to be membrane bound, may be involved in the balance of energy usage/storage in adipocytes. [provided by RefSeq, Jul 2008]

Uniprot Description

PNPLA3: Multifunctional enzyme which has both triacylglycerol lipase and acylglycerol O-acyltransferase activities. Genetic variations in PNPLA3 are a cause of susceptibility to non-alcoholic fatty liver disease type 1 (NAFLD1). A condition characterized by an accumulation of excess triglyceride in the liver, a condition known as hepatic steatosis (or fatty liver), which is associated with adverse metabolic consequences, including insulin resistance and dyslipidemia. In a subset of individuals, hepatic steatosis promotes an inflammatory response in the liver, referred to as steatohepatitis, which can progress to cirrhosis and liver cancer. NAFLD is the most common form of liver disease in Western countries. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Amino Acid Metabolism - tyrosine; EC 3.1.1.3; Lipid Metabolism - glycerolipid; Transferase; Membrane protein, integral; Phospholipase; Amino Acid Metabolism - phenylalanine; Secondary Metabolites Metabolism - limonene and pinene degradation; Lipid Metabolism - glycerophospholipid

Chromosomal Location of Human Ortholog: 22q13.31

Cellular Component: cytoplasm; endoplasmic reticulum membrane; lipid particle; membrane

Molecular Function: acylglycerol O-acyltransferase activity; diolein transacylation activity; lipoprotein lipase activity; mono-olein transacylation activity; phospholipase A2 activity; triacylglycerol lipase activity

Biological Process: lipid homeostasis; triacylglycerol biosynthetic process; triacylglycerol catabolic process

Research Articles on PNPLA3

Similar Products

Product Notes

The PNPLA3 pnpla3 (Catalog #AAA1273718) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccgacg atgtcctgtg gttgcagtgg gtgacctcac aggtgttcac tcgagtgctg atgtgtctgc tccccgcctc caggtcccaa atgccagtga gcagccaaca ggcctcccca tgcacacctg agcaggactg gccctgctgg actccctgct cccccgaggg ctgtccagca gagaccaaag cagaggccac cccgcggtcc atcctcaggt ccagcctgaa cttcttcttg ggcaataaag tacctgctgg tgctgagggg ctctccacct ttcccagttt ttcactagag aagagtctgt ga. It is sometimes possible for the material contained within the vial of "PNPLA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.