Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM55 cdna clone

TRIM55 cDNA Clone

Gene Names
TRIM55; RNF29; muRF2; MURF-2
Synonyms
TRIM55; TRIM55 cDNA Clone; TRIM55 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcgcatctctgaattacaaatctttttccaaagagcagcagaccatggataacttagagaagcaactcatctgtcccatctgcttagagatgttcacgaaacctgtggtgattctcccttgtcagcacaacctgtgtaggaaatgtgccagtgatattttccaggcctctaacccgtatttgcccacaagaggaggtaccaccatggcatcagggggccgattccgctgcccatcctgtagacatgaagtggttttggatagacatggggtatatggacttcagaggaacctgctggtggaaaatatcattgacatctacaagcaggagtccaccaggccagaaaagaaatccgaccagcccatgtgcgaggaacatgaagaggagcgcatcaacatctactgtctgaactgcgaagtacccacctgctctctgtgcaaggtgtttggtgcacacaaagactgccaggtggctcccctcactcatgtgttccagagacagaagtctgagctcagtgatggcatcgccatcctcgtgggcagcaacgatcgagtccagggagtgatcagccagctggaagacacctgcaaaactatcgaggaatgttgcagaaaacagaaacaagagctttgtgagaagtttgattacctgtatggcattttggaggagaggaagaatgaaatgacccaagtcattacccgaacccaagaggagaaactggaacatgtccgtgctctgatcaaaaagtattctgatcatttggagaacgtctcaaagttggttgagtcaggaattcagtttatggatgagccagaaatggcagtgtttctgcagaatgccaaaaccctgctaaaaaaaatctcggaagcatcaaaggcatttcagatggagaaaatagaacatggctatgagaacatgaaccacttcacagtcaacctcaatagagaagaaaagataatacgtgaaattgacttttacagagaagatgaagatgaagaagaagaagaaggcggagaaggagaaaaagaaggagaaggagaagtgggaggagaagcagtagaagtggaagaggtagaaaatgttcaaacagagtttccaggagaagatgaaaacccagaaaaagcttcagagctctctcaggtggagctgcaggctgcccctggggcacttccagtttcctctccagagccacctccagccctgccacctgctgcggatgcccctgtgacacagattggatttgaggctcctcccctccagggacaggctgcagctccagcgagtggcagtggagctgattctgagccagctcgccatatcttctccttttcctggttgaactccctaaatgaatga
Sequence Length
1359
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,841 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 55, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 55
NCBI Official Symbol
TRIM55
NCBI Official Synonym Symbols
RNF29; muRF2; MURF-2
NCBI Protein Information
tripartite motif-containing protein 55
UniProt Protein Name
Tripartite motif-containing protein 55
UniProt Gene Name
TRIM55
UniProt Synonym Gene Names
MURF2; RNF29; MuRF-2; MuRF2
UniProt Entry Name
TRI55_HUMAN

NCBI Description

The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein associates transiently with microtubules, myosin, and titin during muscle sarcomere assembly. It may act as a transient adaptor and plays a regulatory role in the assembly of sarcomeres. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

TRIM55: May regulate gene expression and protein turnover in muscle cells. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Ligase; EC 6.3.2.-; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 8q13.1

Molecular Function: identical protein binding; protein binding

Research Articles on TRIM55

Similar Products

Product Notes

The TRIM55 trim55 (Catalog #AAA1273678) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgcat ctctgaatta caaatctttt tccaaagagc agcagaccat ggataactta gagaagcaac tcatctgtcc catctgctta gagatgttca cgaaacctgt ggtgattctc ccttgtcagc acaacctgtg taggaaatgt gccagtgata ttttccaggc ctctaacccg tatttgccca caagaggagg taccaccatg gcatcagggg gccgattccg ctgcccatcc tgtagacatg aagtggtttt ggatagacat ggggtatatg gacttcagag gaacctgctg gtggaaaata tcattgacat ctacaagcag gagtccacca ggccagaaaa gaaatccgac cagcccatgt gcgaggaaca tgaagaggag cgcatcaaca tctactgtct gaactgcgaa gtacccacct gctctctgtg caaggtgttt ggtgcacaca aagactgcca ggtggctccc ctcactcatg tgttccagag acagaagtct gagctcagtg atggcatcgc catcctcgtg ggcagcaacg atcgagtcca gggagtgatc agccagctgg aagacacctg caaaactatc gaggaatgtt gcagaaaaca gaaacaagag ctttgtgaga agtttgatta cctgtatggc attttggagg agaggaagaa tgaaatgacc caagtcatta cccgaaccca agaggagaaa ctggaacatg tccgtgctct gatcaaaaag tattctgatc atttggagaa cgtctcaaag ttggttgagt caggaattca gtttatggat gagccagaaa tggcagtgtt tctgcagaat gccaaaaccc tgctaaaaaa aatctcggaa gcatcaaagg catttcagat ggagaaaata gaacatggct atgagaacat gaaccacttc acagtcaacc tcaatagaga agaaaagata atacgtgaaa ttgactttta cagagaagat gaagatgaag aagaagaaga aggcggagaa ggagaaaaag aaggagaagg agaagtggga ggagaagcag tagaagtgga agaggtagaa aatgttcaaa cagagtttcc aggagaagat gaaaacccag aaaaagcttc agagctctct caggtggagc tgcaggctgc ccctggggca cttccagttt cctctccaga gccacctcca gccctgccac ctgctgcgga tgcccctgtg acacagattg gatttgaggc tcctcccctc cagggacagg ctgcagctcc agcgagtggc agtggagctg attctgagcc agctcgccat atcttctcct tttcctggtt gaactcccta aatgaatga. It is sometimes possible for the material contained within the vial of "TRIM55, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.