Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNX27 cdna clone

SNX27 cDNA Clone

Gene Names
SNX27; MRT1; MY014
Synonyms
SNX27; SNX27 cDNA Clone; SNX27 cdna clone
Ordering
For Research Use Only!
Sequence
atggacagtacgacagtgaattactttgccttatttgaagtgatcagtcactcctttgtacgtaaattggcacctaatgagtttcctcacaaactctacattcagaattatacatcagctgtgccaggcacctgcttgaccattcgaaagtggctttttacaacagaagaagaaattctcttaaatgacaatgaccttgctgttacctacttctttcatcaggcagtcgatgatgtgaagaaaggttacatcaaagcagaagaaaagtcctatcaattacagaagctatacgaacaaagaaaaatggtcatgtacctcaacatgctaaggacttgtgagggctacaatgaaatcatctttccccactgtgcctgtgactccaggaggaaggggcacgttatcacagccatcagcatcacgcactttaaactgcatgcctgcactgaagaaggacagctggagaaccaggtaattgcatttgaatgggatgagatgcagcgatgggacacagatgaagaagggatggccttctgtttcgaatatgcacgaggagagaagaagccccgatgggttaaaatcttcacgccatatttcaattacatgcatgagtgcttcgagagggtgttctgcgagctcaagtggagaaaagaggaatattag
Sequence Length
660
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,781 Da
NCBI Official Full Name
Homo sapiens sorting nexin family member 27, mRNA
NCBI Official Synonym Full Names
sorting nexin family member 27
NCBI Official Symbol
SNX27
NCBI Official Synonym Symbols
MRT1; MY014
NCBI Protein Information
sorting nexin-27
UniProt Protein Name
Sorting nexin-27
Protein Family
UniProt Gene Name
SNX27
UniProt Synonym Gene Names
KIAA0488
UniProt Entry Name
SNX27_HUMAN

NCBI Description

This gene encodes a member of the sorting nexin family, a diverse group of cytoplasmic and membrane-associated proteins involved in endocytosis of plasma membrane receptors and protein trafficking through these compartments. All members of this protein family contain a phosphoinositide binding domain (PX domain). A highly similar protein in mouse is responsible for the specific recruitment of an isoform of serotonin 5-hydroxytryptamine 4 receptor into early endosomes, suggesting the analogous role for the human protein. [provided by RefSeq, Jul 2008]

Uniprot Description

SNX27: Involved in endocytic trafficking. In T lymphocytes, participates in endocytic recycling pathway. Recruits PSCDBP and HT4R to early endosomes. Belongs to the sorting nexin family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 1q21.3

Cellular Component: cytoplasm; early endosome; immunological synapse; nucleoplasm; retromer complex

Molecular Function: phosphatidylinositol 3-phosphate binding; protein binding

Biological Process: endosome transport; establishment of natural killer cell polarity; intracellular protein transport

Research Articles on SNX27

Similar Products

Product Notes

The SNX27 snx27 (Catalog #AAA1273652) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacagta cgacagtgaa ttactttgcc ttatttgaag tgatcagtca ctcctttgta cgtaaattgg cacctaatga gtttcctcac aaactctaca ttcagaatta tacatcagct gtgccaggca cctgcttgac cattcgaaag tggcttttta caacagaaga agaaattctc ttaaatgaca atgaccttgc tgttacctac ttctttcatc aggcagtcga tgatgtgaag aaaggttaca tcaaagcaga agaaaagtcc tatcaattac agaagctata cgaacaaaga aaaatggtca tgtacctcaa catgctaagg acttgtgagg gctacaatga aatcatcttt ccccactgtg cctgtgactc caggaggaag gggcacgtta tcacagccat cagcatcacg cactttaaac tgcatgcctg cactgaagaa ggacagctgg agaaccaggt aattgcattt gaatgggatg agatgcagcg atgggacaca gatgaagaag ggatggcctt ctgtttcgaa tatgcacgag gagagaagaa gccccgatgg gttaaaatct tcacgccata tttcaattac atgcatgagt gcttcgagag ggtgttctgc gagctcaagt ggagaaaaga ggaatattag. It is sometimes possible for the material contained within the vial of "SNX27, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.