Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MS4A6A cdna clone

MS4A6A cDNA Clone

Gene Names
MS4A6A; CDA01; MS4A6; 4SPAN3; CD20L3; MST090; MSTP090; 4SPAN3.2
Synonyms
MS4A6A; MS4A6A cDNA Clone; MS4A6A cdna clone
Ordering
For Research Use Only!
Sequence
atgacatcacaacctgttcccaatgagaccatcatagtgctcccatcaaatgtcatcaacttctcccaagcagagaaacccgaacccaccaaccaggggcaggatagcctgaagaaacatctacacgcagaaatcaaagttattgggactatccagatcttgtgtggcatgatggtattgagcttggggatcattttggcatctgcttccttctctccaaattttacccaagtgacttctacactgttgaactctgcttacccattcataggaccctttttttttatcatctctggctctctatcaatcgccacagagaaaaggttgaccaagcttttggtgcatagcagcctggttggaagcattctgagtgctctgtctgccctggtgggtttcattatcctgtctgtcaaacaggccaccttaaatcctgcctcactgcagtgtgagttggacaaaaataatataccaacaagaagttatgtttcttacttttatcatgattcactttataccacggactgctatacagccaaagccagtctggctggatccctctctctgatgctgatttgcactctgctggaattctgcctagctgtgctcactgctgtgctgcggtggaaacaggcttactctgacttccctgggagtgtacttttcctgcctcacagttacattggtaattctggcatgtcctcaaaaatgactcatgactgtggatatgaagaactattgacttcttaa
Sequence Length
747
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,438 Da
NCBI Official Full Name
Homo sapiens membrane-spanning 4-domains, subfamily A, member 6A, mRNA
NCBI Official Synonym Full Names
membrane spanning 4-domains A6A
NCBI Official Symbol
MS4A6A
NCBI Official Synonym Symbols
CDA01; MS4A6; 4SPAN3; CD20L3; MST090; MSTP090; 4SPAN3.2
NCBI Protein Information
membrane-spanning 4-domains subfamily A member 6A
UniProt Protein Name
Membrane-spanning 4-domains subfamily A member 6A
UniProt Gene Name
MS4A6A
UniProt Synonym Gene Names
4SPAN3; CD20L3; MS4A6
UniProt Entry Name
M4A6A_HUMAN

NCBI Description

This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.1, among a cluster of family members. Alternative splicing of this gene results in several transcript variants that encode different protein isoforms. [provided by RefSeq, Oct 2011]

Uniprot Description

MS4A6A: May be involved in signal transduction as a component of a multimeric receptor complex. Belongs to the MS4A family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Cell surface

Chromosomal Location of Human Ortholog: 11q12.1

Research Articles on MS4A6A

Similar Products

Product Notes

The MS4A6A ms4a6a (Catalog #AAA1273628) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacatcac aacctgttcc caatgagacc atcatagtgc tcccatcaaa tgtcatcaac ttctcccaag cagagaaacc cgaacccacc aaccaggggc aggatagcct gaagaaacat ctacacgcag aaatcaaagt tattgggact atccagatct tgtgtggcat gatggtattg agcttgggga tcattttggc atctgcttcc ttctctccaa attttaccca agtgacttct acactgttga actctgctta cccattcata ggaccctttt tttttatcat ctctggctct ctatcaatcg ccacagagaa aaggttgacc aagcttttgg tgcatagcag cctggttgga agcattctga gtgctctgtc tgccctggtg ggtttcatta tcctgtctgt caaacaggcc accttaaatc ctgcctcact gcagtgtgag ttggacaaaa ataatatacc aacaagaagt tatgtttctt acttttatca tgattcactt tataccacgg actgctatac agccaaagcc agtctggctg gatccctctc tctgatgctg atttgcactc tgctggaatt ctgcctagct gtgctcactg ctgtgctgcg gtggaaacag gcttactctg acttccctgg gagtgtactt ttcctgcctc acagttacat tggtaattct ggcatgtcct caaaaatgac tcatgactgt ggatatgaag aactattgac ttcttaa. It is sometimes possible for the material contained within the vial of "MS4A6A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.