DNAJC14 cdna clone

DNAJC14 cDNA Clone

Gene Names

DNAJC14; DNAJ; HDJ3; LIP6; DRIP78

Synonyms

DNAJC14; DNAJC14 cDNA Clone; DNAJC14 cdna clone

Ordering
Cat. Num. AAA1273626 For Research Use Only!

Sequence

atggcccagaagcaccccggagaaagagggttgtatggagcccaccacagtggtggtgcctccctcaggactttaggaccctccgtggaccctgaaataccttcattctcaggactcagggactcagcagggactgctcctaatggtacccgctgcctcacagagcactctggtcctaagcacacacagcacccaaacccagcccattggttggacccaagccatggccccccagggggtccaggaccacctagagatgcagaggaccctgatcagagtgagacgtcttcagaagaagaatcaggagtggaccaggaactctcaaaagaaaacgagactgggaaccagaaggatgggaactcttttctttccattccatctgcttgcaactgccagggaacacctggaattccagaagggccttactctgagggaggaaatggttcttctagcaacttttgccaccactgtacctctccagctttgggggaagatgagttggaagaggaatatgatgatgaagaatctctcaagttccccagtgatttttcacgtgtgtccagcggaaagaaacccccatcccggagacagcggcaccgctttccaacgaaggaggatactcgggagggtggacgtagggatcccaggtcccctggtcgacatcggctgggtcggaaacgaagtcaggcagataagcgcaaaggcctgggattgtggggagccgaggaactatgtcaacttggacaggcaggcttttggtggctgattgaactgctggtattggtgggagagtacgtagaaacttgtggccatctcatctatgcctgcaggcaactgaaaagcagtgatttggacctttttcgagtttggatgggagtgtggacagggcggttagggggctgggcccaggtcatgtttcagtttctaagccaggggttttactgtggagtaggactgtttactcgttttcttaagctgctgggtgctttgctgctcctggctctggccctctttttgggctttctacagttgggatggcggtttctggtgggactaggtgaccggttaggctggagggataaggctacctggctcttctcttggctggattctccagccttgcagcgttgcttgactctgctgagagatagcaggccatggcagcggctggtaagaatagttcagtggggctggctggagttgccttgggtcaagcagaatattaataggcaggggaatgcacctgtagctagtgggcgctactgccagcctgaagaggaagtggctcgactcttgaccatggctggggttcctgaggatgagctaaaccctttccatgtactgggggttgaggccacagcatcagatgttgaactgaagaaggcctatagacagctggcagtgatggttcatcctgacaaaaatcatcatccccgggctgaggaggccttcaaggttttgcgagcagcttgggacattgtcagcaatgctgaaaagcgaaaggagtatgagatgaaacgaatggcagagaatgagctgagccggtcagtaaatgagtttctgtccaagctgcaagatgacctcaaggaggcaatgaatactatgatgtgtagccgatgccaaggaaagcataggaggtttgaaatggaccgggaacctaagagtgccagatactgtgctgagtgtaataggctgcatcctgctgaggaaggagacttttgggcagagtcaagcatgttgggcctcaagatcacctactttgcactgatggatggaaaggtgtatgacatcacagagtgggctggatgccagcgtgtaggtatctccccagatacccacagagtcccctatcacatctcatttggttctcggattccaggcaccagagggcggcagagagccaccccagatgcccctcctgctgatcttcaggatttcttgagtcggatctttcaagtacccccagggcagatgcccaatgggaacttctttgcagctcctcagcctgcccctggagccgctgcagcctctaagcccaacagcacagtacccaagggagaagccaaacctaagcggcggaagaaagtgaggaggcccttccaacgttga

Sequence Length

2109

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

109658951

NCBI GeneID

85406

Molecular Weight

78,569 Da

NCBI Official Full Name

Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 14, mRNA

NCBI Official Synonym Full Names

DnaJ heat shock protein family (Hsp40) member C14

NCBI Official Symbol

DNAJC14

NCBI Official Synonym Symbols

DNAJ; HDJ3; LIP6; DRIP78

NCBI Protein Information

dnaJ homolog subfamily C member 14

UniProt Protein Name

DnaJ homolog subfamily C member 14

Protein Family

DnaJ homolog subfamily

UniProt Gene Name

DNAJC14

UniProt Synonym Gene Names

DRIP78; HDJ3; DRIP78; hDj-3

UniProt Entry Name

DJC14_HUMAN

Uniprot Description

DNAJC14: Regulates the export of target proteins, such as DRD1, from the endoplasmic reticulum to the cell surface.

Protein type: Chaperone; Membrane protein, multi-pass; Membrane protein, integral; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 12q13.2

Cellular Component: membrane; nucleolus; nucleoplasm

Research Articles on DNAJC14

1. This suggests that DNAJC14's folding activity normally modulates yellow fever virus NS3/4A/2K cleavage events to liberate appropriate levels of NS3 and NS4A and promote replication complex formation.

Similar Products

Product Notes

The DNAJC14 dnajc14 (Catalog #AAA1273626) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccaga agcaccccgg agaaagaggg ttgtatggag cccaccacag tggtggtgcc tccctcagga ctttaggacc ctccgtggac cctgaaatac cttcattctc aggactcagg gactcagcag ggactgctcc taatggtacc cgctgcctca cagagcactc tggtcctaag cacacacagc acccaaaccc agcccattgg ttggacccaa gccatggccc cccagggggt ccaggaccac ctagagatgc agaggaccct gatcagagtg agacgtcttc agaagaagaa tcaggagtgg accaggaact ctcaaaagaa aacgagactg ggaaccagaa ggatgggaac tcttttcttt ccattccatc tgcttgcaac tgccagggaa cacctggaat tccagaaggg ccttactctg agggaggaaa tggttcttct agcaactttt gccaccactg tacctctcca gctttggggg aagatgagtt ggaagaggaa tatgatgatg aagaatctct caagttcccc agtgattttt cacgtgtgtc cagcggaaag aaacccccat cccggagaca gcggcaccgc tttccaacga aggaggatac tcgggagggt ggacgtaggg atcccaggtc ccctggtcga catcggctgg gtcggaaacg aagtcaggca gataagcgca aaggcctggg attgtgggga gccgaggaac tatgtcaact tggacaggca ggcttttggt ggctgattga actgctggta ttggtgggag agtacgtaga aacttgtggc catctcatct atgcctgcag gcaactgaaa agcagtgatt tggacctttt tcgagtttgg atgggagtgt ggacagggcg gttagggggc tgggcccagg tcatgtttca gtttctaagc caggggtttt actgtggagt aggactgttt actcgttttc ttaagctgct gggtgctttg ctgctcctgg ctctggccct ctttttgggc tttctacagt tgggatggcg gtttctggtg ggactaggtg accggttagg ctggagggat aaggctacct ggctcttctc ttggctggat tctccagcct tgcagcgttg cttgactctg ctgagagata gcaggccatg gcagcggctg gtaagaatag ttcagtgggg ctggctggag ttgccttggg tcaagcagaa tattaatagg caggggaatg cacctgtagc tagtgggcgc tactgccagc ctgaagagga agtggctcga ctcttgacca tggctggggt tcctgaggat gagctaaacc ctttccatgt actgggggtt gaggccacag catcagatgt tgaactgaag aaggcctata gacagctggc agtgatggtt catcctgaca aaaatcatca tccccgggct gaggaggcct tcaaggtttt gcgagcagct tgggacattg tcagcaatgc tgaaaagcga aaggagtatg agatgaaacg aatggcagag aatgagctga gccggtcagt aaatgagttt ctgtccaagc tgcaagatga cctcaaggag gcaatgaata ctatgatgtg tagccgatgc caaggaaagc ataggaggtt tgaaatggac cgggaaccta agagtgccag atactgtgct gagtgtaata ggctgcatcc tgctgaggaa ggagactttt gggcagagtc aagcatgttg ggcctcaaga tcacctactt tgcactgatg gatggaaagg tgtatgacat cacagagtgg gctggatgcc agcgtgtagg tatctcccca gatacccaca gagtccccta tcacatctca tttggttctc ggattccagg caccagaggg cggcagagag ccaccccaga tgcccctcct gctgatcttc aggatttctt gagtcggatc tttcaagtac ccccagggca gatgcccaat gggaacttct ttgcagctcc tcagcctgcc cctggagccg ctgcagcctc taagcccaac agcacagtac ccaagggaga agccaaacct aagcggcgga agaaagtgag gaggcccttc caacgttga. It is sometimes possible for the material contained within the vial of "DNAJC14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

DNAJC14 cdna clone