Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NEIL1 cdna clone

NEIL1 cDNA Clone

Synonyms
NEIL1; NEIL1 cDNA Clone; NEIL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgagggccccgagctgcacctggccagccagtttgtgaatgaggcctgcagggcgctggtgttcggcggctgcgtggagaagtcctctgtcagccgcaaccctgaggtgccctttgagagcagtgcctaccgcatctcagcttcagcccgcggcaaggagctgcgcctgatactgagccctctgcctggggcccagccccaacaggagccactggccctggtcttccgcttcggcatgtccggctcttttcagctggtgccccgcgaggagctgccacgccatgcccacctgcgcttttacacggccccgcctggcccccggctcgccctatgtttcgtggacatccgccggttcggccgctgggaccttgggggaaagtggcagccgggccgcgggccctgtgtcttgcaggagtaccagcagttcagggagaatgtgctacgaaacctagcggataaggcctttgaccggcccatctgcgaggccctcctggaccagaggttcttcaatggcattggcaactatctgcgggcagagatcctgtaccggctgaagatccccccctttgagaaggcccgctcggtcctggaggccctgcagcagcacaggccgagcccggagctgaccctgagccagaagataaggaccaagctgcagaatccagacctgctggagctatgtcactcagtgcccaaggaagtggtccagttggggggcaggggctacgggtcagagagcggggaggaggactttgctgcctttcgagcctggctgcgctgctatggcatgccaggcatgagctccctgcaggaccggcatggccgtaccatctggttccagggggatcctggaccgttggcacccaaagggcgcaagtcccgcaaaaagaaatccaaggccacacagctgagtcctgaggacagagtggaggacgctttgcctccaagcaaggccccttccaggacacgaagggcaaagagagaccttcctaagaggactgcaacccagcggcctgaggggaccagcctccagcaggacccagaagctcccacagtgcccaagaaggggaggaggaaggggcgacaggcagcctctggccactgcagaccccggaaggtcaaggctgacatcccatccttggaaccagaggggacctcagcctcttag
Sequence Length
1173
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,684 Da
NCBI Official Full Name
Homo sapiens nei endonuclease VIII-like 1 (E. coli), mRNA
UniProt Protein Name
Endonuclease 8-like 1
Protein Family
UniProt Gene Name
NEIL1
UniProt Synonym Gene Names
NEH1
UniProt Entry Name
NEIL1_HUMAN

Uniprot Description

NEIL1: Involved in base excision repair of DNA damaged by oxidation or by mutagenic agents. Acts as DNA glycosylase that recognizes and removes damaged bases. Has a preference for oxidized pyrimidines, such as thymine glycol, formamidopyrimidine (Fapy) and 5-hydroxyuracil. Has marginal activity towards 8- oxoguanine. Has AP (apurinic/apyrimidinic) lyase activity and introduces nicks in the DNA strand. Cleaves the DNA backbone by beta-delta elimination to generate a single-strand break at the site of the removed base with both 3'- and 5'-phosphates. Has DNA glycosylase/lyase activity towards mismatched uracil and thymine, in particular in U:C and T:C mismatches. Belongs to the FPG family.

Protein type: EC 4.2.99.18; Lyase; DNA repair, damage; Hydrolase

Chromosomal Location of Human Ortholog: 15q24.2

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: DNA N-glycosylase activity; DNA-(apurinic or apyrimidinic site) lyase activity; hydrolase activity, acting on glycosyl bonds; protein C-terminus binding

Biological Process: base-excision repair; depyrimidination; negative regulation of nuclease activity; response to oxidative stress

Similar Products

Product Notes

The NEIL1 neil1 (Catalog #AAA1273617) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgagg gccccgagct gcacctggcc agccagtttg tgaatgaggc ctgcagggcg ctggtgttcg gcggctgcgt ggagaagtcc tctgtcagcc gcaaccctga ggtgcccttt gagagcagtg cctaccgcat ctcagcttca gcccgcggca aggagctgcg cctgatactg agccctctgc ctggggccca gccccaacag gagccactgg ccctggtctt ccgcttcggc atgtccggct cttttcagct ggtgccccgc gaggagctgc cacgccatgc ccacctgcgc ttttacacgg ccccgcctgg cccccggctc gccctatgtt tcgtggacat ccgccggttc ggccgctggg accttggggg aaagtggcag ccgggccgcg ggccctgtgt cttgcaggag taccagcagt tcagggagaa tgtgctacga aacctagcgg ataaggcctt tgaccggccc atctgcgagg ccctcctgga ccagaggttc ttcaatggca ttggcaacta tctgcgggca gagatcctgt accggctgaa gatccccccc tttgagaagg cccgctcggt cctggaggcc ctgcagcagc acaggccgag cccggagctg accctgagcc agaagataag gaccaagctg cagaatccag acctgctgga gctatgtcac tcagtgccca aggaagtggt ccagttgggg ggcaggggct acgggtcaga gagcggggag gaggactttg ctgcctttcg agcctggctg cgctgctatg gcatgccagg catgagctcc ctgcaggacc ggcatggccg taccatctgg ttccaggggg atcctggacc gttggcaccc aaagggcgca agtcccgcaa aaagaaatcc aaggccacac agctgagtcc tgaggacaga gtggaggacg ctttgcctcc aagcaaggcc ccttccagga cacgaagggc aaagagagac cttcctaaga ggactgcaac ccagcggcct gaggggacca gcctccagca ggacccagaa gctcccacag tgcccaagaa ggggaggagg aaggggcgac aggcagcctc tggccactgc agaccccgga aggtcaaggc tgacatccca tccttggaac cagaggggac ctcagcctct tag. It is sometimes possible for the material contained within the vial of "NEIL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.