Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IRF6 cdna clone

IRF6 cDNA Clone

Gene Names
IRF6; LPS; PIT; PPS; VWS; OFC6; PPS1; VWS1
Synonyms
IRF6; IRF6 cDNA Clone; IRF6 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctccacccccgcagagtccggctaaagccctggctggtggcccaggtggatagtggcctctaccctgggctcatctggctacacagggactctaaacgcttccagattccctggaaacatgccacccggcatagccctcaacaagaagaggaaaataccatttttaaggcctgggctgtagagacagggaagtaccaggaaggggtggatgaccctgacccagctaaatggaaggcccagctgcgctgtgctctcaataagagcagagaattcaacctgatgtatgatggcaccaaggaggtgcccatgaacccagtgaagatatatcaagtgtgtgacatccctcagccccagggctcgatcattaacccaggatccacagggtctgctccctgggatgagaaggataatgatgtggatgaagaagatgaggaagatgagctggatcagtcgcagcaccatgttcccatccaggacaccttccccttcctgaacatcaatggttctcccatggcgccagccagtgtgggcaattgcagtgtgggcaactgcagcccggaggcagtgtggcccaaaactgaacccctggagatggaagtaccccaggcacctatacagcccttctatagctctccagaactgtggatcagctctctcccaatgactgacctggacatcaagtttcagtaccgtgggaaggagtacgggcagaccatgaccgtgagcaaccctcagggctgccgactcttctatggggacctgggtcccatgcctgaccaggaggagctctttggtcccgtcagcctggagcaggtcaaattcccaggtcctgagcatattaccaatgagaagcagaagctgttcactagcaagctgctggacgtcatggacagaggactgatcctggaggtcagcggtcatgccatttatgccatcaggctgtgccagtgcaaggtgtactggtctgggccatgtgccccatcacttgttgctcccaacctgattgagagacaaaagaaggtcaagctattttgtctggaaacattccttagcgatctcattgcccaccagaaaggacagatagagaagcagccaccgtttgagatctacttatgctttggggaagaatggccagatgggaaaccattggaaaggaaactcatcttggttcaggtcattccagtagtggctcggatgatctacgagatgttttctggtgatttcacacgatcctttgatagtggcagtgtccgcctgcagatctcaaccccagacatcaaggataacatcgttgctcagctgaagcagctgtaccgcatccttcaaacccaggagagctggcagcccatgcagcccacccccagcatgcaactgccccctgccctgcctccccagtaa
Sequence Length
1404
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,930 Da
NCBI Official Full Name
Homo sapiens interferon regulatory factor 6, mRNA
NCBI Official Synonym Full Names
interferon regulatory factor 6
NCBI Official Symbol
IRF6
NCBI Official Synonym Symbols
LPS; PIT; PPS; VWS; OFC6; PPS1; VWS1
NCBI Protein Information
interferon regulatory factor 6
UniProt Protein Name
Interferon regulatory factor 6
UniProt Gene Name
IRF6
UniProt Synonym Gene Names
IRF-6
UniProt Entry Name
IRF6_HUMAN

NCBI Description

This gene encodes a member of the interferon regulatory transcription factor (IRF) family. Family members share a highly-conserved N-terminal helix-turn-helix DNA-binding domain and a less conserved C-terminal protein-binding domain. The encoded protein may be a transcriptional activator. Mutations in this gene can cause van der Woude syndrome and popliteal pterygium syndrome. Mutations in this gene are also associated with non-syndromic orofacial cleft type 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2011]

Uniprot Description

IRF6: Probable DNA-binding transcriptional activator. Key determinant of the keratinocyte proliferation-differentiation switch involved in appropriate epidermal development. Plays a role in regulating mammary epithelial cell proliferation. May regulate WDR65 transcription. Interacts with SERPINB5. Expressed in normal mammary epithelial cells. Expression is reduced or absent in breast carcinomas. Belongs to the IRF family.

Protein type: Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 1q32.3-q41

Cellular Component: cytoplasm; cytosol

Molecular Function: DNA binding; protein binding; transcription factor activity

Biological Process: cell cycle arrest; negative regulation of cell proliferation; positive regulation of transcription, DNA-dependent

Disease: Orofacial Cleft 6, Susceptibility To; Popliteal Pterygium Syndrome; Van Der Woude Syndrome 1

Research Articles on IRF6

Similar Products

Product Notes

The IRF6 irf6 (Catalog #AAA1273550) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctcc acccccgcag agtccggcta aagccctggc tggtggccca ggtggatagt ggcctctacc ctgggctcat ctggctacac agggactcta aacgcttcca gattccctgg aaacatgcca cccggcatag ccctcaacaa gaagaggaaa ataccatttt taaggcctgg gctgtagaga cagggaagta ccaggaaggg gtggatgacc ctgacccagc taaatggaag gcccagctgc gctgtgctct caataagagc agagaattca acctgatgta tgatggcacc aaggaggtgc ccatgaaccc agtgaagata tatcaagtgt gtgacatccc tcagccccag ggctcgatca ttaacccagg atccacaggg tctgctccct gggatgagaa ggataatgat gtggatgaag aagatgagga agatgagctg gatcagtcgc agcaccatgt tcccatccag gacaccttcc ccttcctgaa catcaatggt tctcccatgg cgccagccag tgtgggcaat tgcagtgtgg gcaactgcag cccggaggca gtgtggccca aaactgaacc cctggagatg gaagtacccc aggcacctat acagcccttc tatagctctc cagaactgtg gatcagctct ctcccaatga ctgacctgga catcaagttt cagtaccgtg ggaaggagta cgggcagacc atgaccgtga gcaaccctca gggctgccga ctcttctatg gggacctggg tcccatgcct gaccaggagg agctctttgg tcccgtcagc ctggagcagg tcaaattccc aggtcctgag catattacca atgagaagca gaagctgttc actagcaagc tgctggacgt catggacaga ggactgatcc tggaggtcag cggtcatgcc atttatgcca tcaggctgtg ccagtgcaag gtgtactggt ctgggccatg tgccccatca cttgttgctc ccaacctgat tgagagacaa aagaaggtca agctattttg tctggaaaca ttccttagcg atctcattgc ccaccagaaa ggacagatag agaagcagcc accgtttgag atctacttat gctttgggga agaatggcca gatgggaaac cattggaaag gaaactcatc ttggttcagg tcattccagt agtggctcgg atgatctacg agatgttttc tggtgatttc acacgatcct ttgatagtgg cagtgtccgc ctgcagatct caaccccaga catcaaggat aacatcgttg ctcagctgaa gcagctgtac cgcatccttc aaacccagga gagctggcag cccatgcagc ccacccccag catgcaactg ccccctgccc tgcctcccca gtaa. It is sometimes possible for the material contained within the vial of "IRF6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.