Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHERP cdna clone

CHERP cDNA Clone

Gene Names
CHERP; SRA1; DAN16; SCAF6
Synonyms
CHERP; CHERP cDNA Clone; CHERP cdna clone
Ordering
For Research Use Only!
Sequence
atgactatggagaagcagaaggacaaccccaaattctcgtttcttttcggaggcgaattctacagttactacaagtgcaagctggcgctggagcagcagcagctcatctgcaagcagcagaccccggagctggagccagccgccaccatgccacccctgccacagcccccgctggcccccgccgcgcccatcccgccggcccagggcgcgccatccatggacgagctcatccagcagagccagtggaacctccagcagcaggagcagcacttgctggcgctcagacaggagcaagtgacagcggccgtggcccacgcggtggagcagcagatgcagaagcttctggaggagacccagctagacatgaacgagtttgacaacctcctgcagcccatcatcgacacgtgcaccaaggacgccatctcggccgggaagaactggatgttcagcaatgccaagtccccgccgcactgtgagctgatggccggccacctccggaaccgcatcacggctgatggggcacacttcgagctgcggctgcacctcatctacctgatcaatgacgtgctgcaccactgccagcgcaagcaggcccgggagctgctggccgccctgcagaaggtcgtggtgcccatctactgcaccagcttcttggccgtggaggaagacaagcagcagaagatcgcccggctcctgcagctctgggagaaaaacggctacttcgatgactccatcattcagcagctacagagcccagccctggggcttggtcagtaccaggccaccctcatcaacgagtactcctcagtggtccagccggtgcagctggccttccagcagcagatccagaccctcaagacgcagcacgaggagtttgtcaccagcctggcccagcagcagcagcagcagcaacagcagcagcagcagctccagatgccgcagatggaggctgaagtcaaggccacgcctccaccgcctgctccacccccggccccagcacctgcccctgccatcccgcccaccacccagcctgatgacagcaagcctcccatccagatgcctggctcttcagagtacgaagctccaggaggggtccaggatcctgcagctgccggcccccggggccccgggccacacgaccagatcccaccaaacaagcccccttggtttgaccagcctcaccccgtggctccttggggccagcagcagccgccagagcagccaccctacccgcaccaccagggcggcccaccccactgccccccctggaacaacagccatgagggcatgtggggcgagcagcgcggtgaccccggctggaacggccagcgcgacgcgccctggaacaaccagcccgacgccgcctggaacagccagttcgagggcccctggaacagccagcacgagcagccgccctggggcgggggccagcgcgagccacccttccgcatgcagcggcccccacacttccgggggcccttcccgccccaccagcagcacccgcagttcaaccagcctccgcacccccacaacttcaaccgcttcccgccccgcttcatgcaggacgacttcccgccacggcaccccttcgagcggccgccctatccccaccgcttcgactacccccagggggacttccctgccgaaatggggccccctcaccaccaccctggccaccgcatgcctcatcctggcatcaacgagcacccgccttgggctggaccccagcaccctgacttcggccctcccccccatggcttcaacgggcagcccccacacatgcggcgacagggcccgccccacatcaaccacgatgaccccagcctggtccccaatgtgccctacttcgatctccctgctgggctgatggcccccctcgtgaagctggaagatcacgagtacaagcctttggaccctaaagacatccgcctcccaccccccatgccgcccagcgagaggctgctggctgcagtggaggccttctacagccccccgtcccacgacaggcccaggaacagtgaaggctgggagcagaacggcctctatgagttcttccgagcaaaaatgcgggcccggcggaggaaaggccaggagaagaggaacagcggaccctcgaggtctcggagcagatccaagagtcgagggcgttcttcctcccgctccaactcaagatcctccaagtcttcaggctcgtactcaaggtcaaggtcgcgctcctgctcccgttcctactcccgctccagatctagaagtcggagcaggtcgcgctcctccagaagccgctcccggtcccagtcgcggtcccggtccaagtcgtactccccaggaagaagacgccggtcacggtccaggagccccaccccgccttcctctgctggtctgggttctaattcggcgcctcccattcctgactcaaggctcggagaagagaacaaaggccatcagatgctggtgaagatgggctggagcggctcaggcggcctcggtgcgaaggagcaagggatccaggaccccatcaagggcggggacgtccgggataagtgggaccagtataaaggcgtgggcgtggctctggatgacccctatgagaactaccgcaggaacaagagctactccttcatcgcccgcatgaaggccagggacgagtgtaagtag
Sequence Length
2655
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
103,702 Da
NCBI Official Full Name
Homo sapiens calcium homeostasis endoplasmic reticulum protein, mRNA
NCBI Official Synonym Full Names
calcium homeostasis endoplasmic reticulum protein
NCBI Official Symbol
CHERP
NCBI Official Synonym Symbols
SRA1; DAN16; SCAF6
NCBI Protein Information
calcium homeostasis endoplasmic reticulum protein
UniProt Protein Name
Calcium homeostasis endoplasmic reticulum protein
UniProt Gene Name
CHERP
UniProt Entry Name
CHERP_HUMAN

Uniprot Description

CHERP: Involved in calcium homeostasis, growth and proliferation.

Protein type: RNA-binding; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 19p13.1

Cellular Component: cytoplasm; membrane; perinuclear region of cytoplasm; sarcoplasmic reticulum membrane

Molecular Function: protein binding

Biological Process: cellular calcium ion homeostasis; negative regulation of cell proliferation; nervous system development; positive regulation of NFAT protein import into nucleus; release of sequestered calcium ion into cytosol

Research Articles on CHERP

Similar Products

Product Notes

The CHERP cherp (Catalog #AAA1273540) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactatgg agaagcagaa ggacaacccc aaattctcgt ttcttttcgg aggcgaattc tacagttact acaagtgcaa gctggcgctg gagcagcagc agctcatctg caagcagcag accccggagc tggagccagc cgccaccatg ccacccctgc cacagccccc gctggccccc gccgcgccca tcccgccggc ccagggcgcg ccatccatgg acgagctcat ccagcagagc cagtggaacc tccagcagca ggagcagcac ttgctggcgc tcagacagga gcaagtgaca gcggccgtgg cccacgcggt ggagcagcag atgcagaagc ttctggagga gacccagcta gacatgaacg agtttgacaa cctcctgcag cccatcatcg acacgtgcac caaggacgcc atctcggccg ggaagaactg gatgttcagc aatgccaagt ccccgccgca ctgtgagctg atggccggcc acctccggaa ccgcatcacg gctgatgggg cacacttcga gctgcggctg cacctcatct acctgatcaa tgacgtgctg caccactgcc agcgcaagca ggcccgggag ctgctggccg ccctgcagaa ggtcgtggtg cccatctact gcaccagctt cttggccgtg gaggaagaca agcagcagaa gatcgcccgg ctcctgcagc tctgggagaa aaacggctac ttcgatgact ccatcattca gcagctacag agcccagccc tggggcttgg tcagtaccag gccaccctca tcaacgagta ctcctcagtg gtccagccgg tgcagctggc cttccagcag cagatccaga ccctcaagac gcagcacgag gagtttgtca ccagcctggc ccagcagcag cagcagcagc aacagcagca gcagcagctc cagatgccgc agatggaggc tgaagtcaag gccacgcctc caccgcctgc tccacccccg gccccagcac ctgcccctgc catcccgccc accacccagc ctgatgacag caagcctccc atccagatgc ctggctcttc agagtacgaa gctccaggag gggtccagga tcctgcagct gccggccccc ggggccccgg gccacacgac cagatcccac caaacaagcc cccttggttt gaccagcctc accccgtggc tccttggggc cagcagcagc cgccagagca gccaccctac ccgcaccacc agggcggccc accccactgc cccccctgga acaacagcca tgagggcatg tggggcgagc agcgcggtga ccccggctgg aacggccagc gcgacgcgcc ctggaacaac cagcccgacg ccgcctggaa cagccagttc gagggcccct ggaacagcca gcacgagcag ccgccctggg gcgggggcca gcgcgagcca cccttccgca tgcagcggcc cccacacttc cgggggccct tcccgcccca ccagcagcac ccgcagttca accagcctcc gcacccccac aacttcaacc gcttcccgcc ccgcttcatg caggacgact tcccgccacg gcaccccttc gagcggccgc cctatcccca ccgcttcgac tacccccagg gggacttccc tgccgaaatg gggccccctc accaccaccc tggccaccgc atgcctcatc ctggcatcaa cgagcacccg ccttgggctg gaccccagca ccctgacttc ggccctcccc cccatggctt caacgggcag cccccacaca tgcggcgaca gggcccgccc cacatcaacc acgatgaccc cagcctggtc cccaatgtgc cctacttcga tctccctgct gggctgatgg cccccctcgt gaagctggaa gatcacgagt acaagccttt ggaccctaaa gacatccgcc tcccaccccc catgccgccc agcgagaggc tgctggctgc agtggaggcc ttctacagcc ccccgtccca cgacaggccc aggaacagtg aaggctggga gcagaacggc ctctatgagt tcttccgagc aaaaatgcgg gcccggcgga ggaaaggcca ggagaagagg aacagcggac cctcgaggtc tcggagcaga tccaagagtc gagggcgttc ttcctcccgc tccaactcaa gatcctccaa gtcttcaggc tcgtactcaa ggtcaaggtc gcgctcctgc tcccgttcct actcccgctc cagatctaga agtcggagca ggtcgcgctc ctccagaagc cgctcccggt cccagtcgcg gtcccggtcc aagtcgtact ccccaggaag aagacgccgg tcacggtcca ggagccccac cccgccttcc tctgctggtc tgggttctaa ttcggcgcct cccattcctg actcaaggct cggagaagag aacaaaggcc atcagatgct ggtgaagatg ggctggagcg gctcaggcgg cctcggtgcg aaggagcaag ggatccagga ccccatcaag ggcggggacg tccgggataa gtgggaccag tataaaggcg tgggcgtggc tctggatgac ccctatgaga actaccgcag gaacaagagc tactccttca tcgcccgcat gaaggccagg gacgagtgta agtag. It is sometimes possible for the material contained within the vial of "CHERP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.