Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX19A cdna clone

DDX19A cDNA Clone

Gene Names
DDX19A; DDX19L; DDX19-DDX19L
Synonyms
DDX19A; DDX19A cDNA Clone; DDX19A cdna clone
Ordering
For Research Use Only!
Sequence
atggccaccgactcgtgggccctggcggtggacgagcaggaagcggctgtcaagtcgatgaccaatttgcagatcaaggaagagaaagtcaaagcagataccaatggtattatcaaaaccagtaccactgccgagaaaacagatgaagaggagaaagaggacagagctgcccagtccttactcaacaagctgatcagaagcaaccttgttgataacacaaaccaagtggaagtcctgcaacgggatccaaactcccctctgtactcggtgaagtcgtttgaagagcttcggctgaaaccacagcttctccagggagtctatgccatgggcttcaatcgaccctccaagatacaagagaacgcattacccatgatgcttgctgaacccccacagaatctgattgcccagtctcagtctggcactggtaaaacagctgcctttgtcttagccatgctcagccgagtggagccatcagacagatacccccagtgtctgtgcctctccccaacatatgagctggcgcttcaaacaggaaaagtgattgagcagatgggcaaattttacccagaactgaagcttgcctatgccgttcgaggcaataaattggaaagaggccagaagatcagtgagcagattgtcattggcacccctgggaccgtgctggactggtgctccaagctcaagttcattgatcccaagaaaatcaaggtgtttgttctggatgaggctgatgtcatgatagccactcagggccaccaagatcagagcatccgcatccagaggatgctgcccaggaactgccagatgctgcttttctccgccacctttgaagactctgtgtggaagtttgcccagaaagtggtcccagacccaaatgttatcaaactgaagcgtgaggaagagaccctggataccatcaagcagtactatgtcctgtgcagcagcagagacgagaagttccaggccttgtgtaacctctacggggccatcaccattgctcaagccatgatcttctgccatactcgcaaaacagctagttggctggcagcagagctctcaaaagaaggccaccaggtggctctgctgagtggggagatgatggtggagcagagggctgcggtgattgagcgcttccgagagggcaaagagaaggttttggtgaccaccaacgtgtgtgcccgcggcattgatgttgaacaagtgtctgtcgtcatcaactttgatcttcccgtggacaaggacgggaatcctgacaatgagacctacctgcaccggatcgggcgcacgggccgctttggcaagaggggcctggcagtgaacatggtggacagcaagcacagcatgaacatcctgaacagaatccaggagcattttaataagaagatagaaagattggacacagatgatttggacgagattgagaaaatagccaactga
Sequence Length
1437
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,875 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-As) box polypeptide 19A, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 19A
NCBI Official Symbol
DDX19A
NCBI Official Synonym Symbols
DDX19L; DDX19-DDX19L
NCBI Protein Information
ATP-dependent RNA helicase DDX19A
UniProt Protein Name
ATP-dependent RNA helicase DDX19A
UniProt Gene Name
DDX19A
UniProt Synonym Gene Names
DDX19L
UniProt Entry Name
DD19A_HUMAN

Uniprot Description

DDX19A: ATP-dependent RNA helicase involved in mRNA export from the nucleus. Belongs to the DEAD box helicase family. DDX19/DBP5 subfamily.

Protein type: EC 3.6.4.13; Helicase

Chromosomal Location of Human Ortholog: 16q22.1

Cellular Component: cytoplasm; membrane; nucleus

Molecular Function: ATP-dependent RNA helicase activity; protein binding

Biological Process: mRNA export from nucleus; RNA secondary structure unwinding

Similar Products

Product Notes

The DDX19A ddx19a (Catalog #AAA1273507) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaccg actcgtgggc cctggcggtg gacgagcagg aagcggctgt caagtcgatg accaatttgc agatcaagga agagaaagtc aaagcagata ccaatggtat tatcaaaacc agtaccactg ccgagaaaac agatgaagag gagaaagagg acagagctgc ccagtcctta ctcaacaagc tgatcagaag caaccttgtt gataacacaa accaagtgga agtcctgcaa cgggatccaa actcccctct gtactcggtg aagtcgtttg aagagcttcg gctgaaacca cagcttctcc agggagtcta tgccatgggc ttcaatcgac cctccaagat acaagagaac gcattaccca tgatgcttgc tgaaccccca cagaatctga ttgcccagtc tcagtctggc actggtaaaa cagctgcctt tgtcttagcc atgctcagcc gagtggagcc atcagacaga tacccccagt gtctgtgcct ctccccaaca tatgagctgg cgcttcaaac aggaaaagtg attgagcaga tgggcaaatt ttacccagaa ctgaagcttg cctatgccgt tcgaggcaat aaattggaaa gaggccagaa gatcagtgag cagattgtca ttggcacccc tgggaccgtg ctggactggt gctccaagct caagttcatt gatcccaaga aaatcaaggt gtttgttctg gatgaggctg atgtcatgat agccactcag ggccaccaag atcagagcat ccgcatccag aggatgctgc ccaggaactg ccagatgctg cttttctccg ccacctttga agactctgtg tggaagtttg cccagaaagt ggtcccagac ccaaatgtta tcaaactgaa gcgtgaggaa gagaccctgg ataccatcaa gcagtactat gtcctgtgca gcagcagaga cgagaagttc caggccttgt gtaacctcta cggggccatc accattgctc aagccatgat cttctgccat actcgcaaaa cagctagttg gctggcagca gagctctcaa aagaaggcca ccaggtggct ctgctgagtg gggagatgat ggtggagcag agggctgcgg tgattgagcg cttccgagag ggcaaagaga aggttttggt gaccaccaac gtgtgtgccc gcggcattga tgttgaacaa gtgtctgtcg tcatcaactt tgatcttccc gtggacaagg acgggaatcc tgacaatgag acctacctgc accggatcgg gcgcacgggc cgctttggca agaggggcct ggcagtgaac atggtggaca gcaagcacag catgaacatc ctgaacagaa tccaggagca ttttaataag aagatagaaa gattggacac agatgatttg gacgagattg agaaaatagc caactga. It is sometimes possible for the material contained within the vial of "DDX19A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.