Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB39B cdna clone

RAB39B cDNA Clone

Gene Names
RAB39B; WSMN; MRX72
Synonyms
RAB39B; RAB39B cDNA Clone; RAB39B cdna clone
Ordering
For Research Use Only!
Sequence
atggaggccatctggctgtaccagttccggctcattgtcatcggggattccacagtgggcaagtcctgcctgatccgccgcttcaccgagggtcgctttgcccaggtttctgaccccaccgtgggggtggattttttctcccgcttggtggagatcgagccaggaaaacgcatcaagctccagatctgggataccgcgggtcaagagaggttcagatccatcactcgcgcctactacaggaactcagtaggtggtcttctcttatttgacattaccaaccgcaggtccttccagaatgtccatgagtggttagaagagaccaaagtacacgttcagccctaccaaattgtatttgttctggtgggtcacaagtgtgacctggatacacagaggcaagtgactcgccacgaggccgagaaactggctgctgcatacggcatgaagtacattgaaacgtcagcccgagatgccattaatgtggagaaagccttcacagacctgacaagagacatatatgagctggttaaaaggggggagattacaatccaggagggctgggaaggggtgaagagtggatttgtaccaaatgtggttcactcttcagaagaggttgtcaaatcagagaggagatgtttgtgctag
Sequence Length
642
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,622 Da
NCBI Official Full Name
Homo sapiens RAB39B, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB39B, member RAS oncogene family
NCBI Official Symbol
RAB39B
NCBI Official Synonym Symbols
WSMN; MRX72
NCBI Protein Information
ras-related protein Rab-39B
UniProt Protein Name
Ras-related protein Rab-39B
Protein Family
UniProt Gene Name
RAB39B
UniProt Entry Name
RB39B_HUMAN

NCBI Description

This gene encodes a member of the Rab family of proteins. Rab proteins are small GTPases that are involved in vesicular trafficking. Mutations in this gene are associated with X-linked mental retardation. [provided by RefSeq, Aug 2013]

Uniprot Description

RAB39B: May be involved in vesicular trafficking. Plays a role in synapse formation. Defects in RAB39B are the cause of mental retardation X- linked type 72 (MRX72). Mental retardation is characterized by significantly below average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. MRX72 patients can manifest autism spectrum disorder, seizures and macrocephaly as additional features. Belongs to the small GTPase superfamily. Rab family.

Protein type: G protein, monomeric; G protein; G protein, monomeric, Rab

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: Golgi apparatus; intracellular; neuron projection; vesicle

Molecular Function: myosin V binding; protein binding

Biological Process: synapse organization and biogenesis; vesicle-mediated transport

Disease: Mental Retardation, X-linked 72

Research Articles on RAB39B

Similar Products

Product Notes

The RAB39B rab39b (Catalog #AAA1273442) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcca tctggctgta ccagttccgg ctcattgtca tcggggattc cacagtgggc aagtcctgcc tgatccgccg cttcaccgag ggtcgctttg cccaggtttc tgaccccacc gtgggggtgg attttttctc ccgcttggtg gagatcgagc caggaaaacg catcaagctc cagatctggg ataccgcggg tcaagagagg ttcagatcca tcactcgcgc ctactacagg aactcagtag gtggtcttct cttatttgac attaccaacc gcaggtcctt ccagaatgtc catgagtggt tagaagagac caaagtacac gttcagccct accaaattgt atttgttctg gtgggtcaca agtgtgacct ggatacacag aggcaagtga ctcgccacga ggccgagaaa ctggctgctg catacggcat gaagtacatt gaaacgtcag cccgagatgc cattaatgtg gagaaagcct tcacagacct gacaagagac atatatgagc tggttaaaag gggggagatt acaatccagg agggctggga aggggtgaag agtggatttg taccaaatgt ggttcactct tcagaagagg ttgtcaaatc agagaggaga tgtttgtgct ag. It is sometimes possible for the material contained within the vial of "RAB39B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.