Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMEM106B cdna clone

TMEM106B cDNA Clone

Synonyms
TMEM106B; TMEM106B cDNA Clone; TMEM106B cdna clone
Ordering
For Research Use Only!
Sequence
atgggaaagtctctttctcatttgcctttgcattcaagcaaagaagatgcttatgatggagtcacatctgaaaacatgaggaatggactggttaatagtgaagtccataatgaagatggaagaaatggagatgtctctcagtttccatatgtggaatttacaggaagagatagtgtcacctgccctacttgtcagggaacaggaagaattcctagggggcaagaaaaccaactggtggcattgattccatatagtgatcagagattaaggccaagaagaacaaagctgtatgtgatggcttctgtgtttgtctgtctactcctttctggattggctgtgtttttccttttccctcgctctatcgacgtgaaatacattggtgtaaaatcagcctatgtcagttatgatgttcagaagcgtacaatttatttaaatatcacaaacacactaaatataacaaacaataactattactctgtcgaagttgaaaacatcactgcccaagttcaattttcaaaaacagttattggaaaggcacgcttaaacaacataaccattattggtccacttgatatgaaacaaattgattacacagtacctaccgttatagcagaggaaatgagttatatgtatgatttctgtactctgatatccatcaaagtgcataacatagtactcatgatgcaagttactgtgacaacaacatactttggccactctgaacagatatcccaggagaggtatcagtatgtcgactgtggaagaaacacaacttatcagttggggcagtctgaatatttaaatgtacttcagccacaacagtaa
Sequence Length
825
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,127 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 106B, mRNA
NCBI Official Synonym Full Names
transmembrane protein 106B
NCBI Official Symbol
TMEM106B
NCBI Protein Information
transmembrane protein 106B
UniProt Protein Name
Transmembrane protein 106B
Protein Family
UniProt Gene Name
TMEM106B
UniProt Entry Name
T106B_HUMAN

Uniprot Description

TMEM106B: TMEM106B genotype, when containing 3 particular single-nucleotide polymorphisms, is strongly correlated with frontotemporal lobar degeneration with TAR DNA-binding protein (TDP-43) inclusions (FTLD-TDP). Frontotemporal lobar degeneration (FTLD) is the second most common cause of presenile dementia and 20% of patients with this neurodegenerative disease have autosomal dominant GRN mutations. Expression of TMEM106B associated with these polymorphisms is increased in frontal cortex of patients with FTLD-TDP compared to unaffected controls. Thus, increased TMEM106B expression in the brain may be linked to mechanisms of disease in FTLD-TDP and risk alleles confer genetic susceptibility by increasing gene expression. Belongs to the TMEM106 family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 7p21.3

Cellular Component: intracellular membrane-bound organelle; lysosomal membrane

Molecular Function: protein binding

Biological Process: dendrite morphogenesis; lysosomal transport; lysosome localization; lysosome organization and biogenesis

Research Articles on TMEM106B

Similar Products

Product Notes

The TMEM106B tmem106b (Catalog #AAA1273389) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaaagt ctctttctca tttgcctttg cattcaagca aagaagatgc ttatgatgga gtcacatctg aaaacatgag gaatggactg gttaatagtg aagtccataa tgaagatgga agaaatggag atgtctctca gtttccatat gtggaattta caggaagaga tagtgtcacc tgccctactt gtcagggaac aggaagaatt cctagggggc aagaaaacca actggtggca ttgattccat atagtgatca gagattaagg ccaagaagaa caaagctgta tgtgatggct tctgtgtttg tctgtctact cctttctgga ttggctgtgt ttttcctttt ccctcgctct atcgacgtga aatacattgg tgtaaaatca gcctatgtca gttatgatgt tcagaagcgt acaatttatt taaatatcac aaacacacta aatataacaa acaataacta ttactctgtc gaagttgaaa acatcactgc ccaagttcaa ttttcaaaaa cagttattgg aaaggcacgc ttaaacaaca taaccattat tggtccactt gatatgaaac aaattgatta cacagtacct accgttatag cagaggaaat gagttatatg tatgatttct gtactctgat atccatcaaa gtgcataaca tagtactcat gatgcaagtt actgtgacaa caacatactt tggccactct gaacagatat cccaggagag gtatcagtat gtcgactgtg gaagaaacac aacttatcag ttggggcagt ctgaatattt aaatgtactt cagccacaac agtaa. It is sometimes possible for the material contained within the vial of "TMEM106B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.