Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FMO5 cdna clone

FMO5 cDNA Clone

Synonyms
FMO5; FMO5 cDNA Clone; FMO5 cdna clone
Ordering
For Research Use Only!
Sequence
atgactaagaaaagaattgctgtgattgggggaggagtgagcgggctctcttccatcaagtgctgcgtagaagaaggcttggaacctgtctgctttgaaaggactgatgacatcggagggctctggaggttccaggaaaatcctgaagaaggaagggccagtatttacaaatcagtgatcatcaatacttctaaagagatgatgtgcttcagtgactatccaatcccagatcattatcccaacttcatgcataatgcccaggtcctggagtatttcaggatgtatgccaaagaatttgaccttctaaagtatattcgatttaagaccactgtgtgcagtgtgaagaagcagcctgattttgccacttcaggccaatgggaagtggtcactgaatctgaagggaaaaaggagatgaatgtctttgatggagtcatggtttgcactggccatcacaccaatgctcatctacctctggaaagcttccctggaattgagaagttcaaagggcagtacttccacagtcgagactataagaacccagagggattcactggaaagagagtcattataattggcattgggaattctggaggggatctggctgtagagattagccaaacagccaagcaggttttcctcagcaccaggagaggggcttggatcctgaatcgtgtaggggactacggatatcctgctgatgtgttgttctcttctcgacttacacattttatatggaagatctgtggccaatcattagcaaacaaatatttggaaaaaaagataaaccaaaggtttgaccatgaaatgtttggcctgaagcctaaacacaggtctaaagacattgccctcacagagtga
Sequence Length
858
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,477 Da
NCBI Official Full Name
Homo sapiens flavin containing monooxygenase 5, mRNA
NCBI Official Synonym Full Names
flavin containing monooxygenase 5
NCBI Official Symbol
FMO5
NCBI Protein Information
dimethylaniline monooxygenase [N-oxide-forming] 5
UniProt Protein Name
Dimethylaniline monooxygenase [N-oxide-forming] 5
UniProt Gene Name
FMO5
UniProt Synonym Gene Names
FMO 5
UniProt Entry Name
FMO5_HUMAN

NCBI Description

Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]

Uniprot Description

FMO5: In contrast with other forms of FMO it does not seem to be a drug-metabolizing enzyme. Belongs to the FMO family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Xenobiotic Metabolism - drug metabolism - cytochrome P450; Oxidoreductase; EC 1.14.13.8

Chromosomal Location of Human Ortholog: 1q21.1

Cellular Component: cytoplasm; endoplasmic reticulum

Molecular Function: flavin-containing monooxygenase activity

Biological Process: drug metabolic process

Research Articles on FMO5

Similar Products

Product Notes

The FMO5 fmo5 (Catalog #AAA1273338) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactaaga aaagaattgc tgtgattggg ggaggagtga gcgggctctc ttccatcaag tgctgcgtag aagaaggctt ggaacctgtc tgctttgaaa ggactgatga catcggaggg ctctggaggt tccaggaaaa tcctgaagaa ggaagggcca gtatttacaa atcagtgatc atcaatactt ctaaagagat gatgtgcttc agtgactatc caatcccaga tcattatccc aacttcatgc ataatgccca ggtcctggag tatttcagga tgtatgccaa agaatttgac cttctaaagt atattcgatt taagaccact gtgtgcagtg tgaagaagca gcctgatttt gccacttcag gccaatggga agtggtcact gaatctgaag ggaaaaagga gatgaatgtc tttgatggag tcatggtttg cactggccat cacaccaatg ctcatctacc tctggaaagc ttccctggaa ttgagaagtt caaagggcag tacttccaca gtcgagacta taagaaccca gagggattca ctggaaagag agtcattata attggcattg ggaattctgg aggggatctg gctgtagaga ttagccaaac agccaagcag gttttcctca gcaccaggag aggggcttgg atcctgaatc gtgtagggga ctacggatat cctgctgatg tgttgttctc ttctcgactt acacatttta tatggaagat ctgtggccaa tcattagcaa acaaatattt ggaaaaaaag ataaaccaaa ggtttgacca tgaaatgttt ggcctgaagc ctaaacacag gtctaaagac attgccctca cagagtga. It is sometimes possible for the material contained within the vial of "FMO5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.