PMPCA cdna clone
PMPCA cDNA Clone
Gene Names
PMPCA; P-55; SCAR2; INPP5E; Alpha-MPP
Synonyms
PMPCA; PMPCA cDNA Clone; PMPCA cdna clone
Sequence
atggcggctgtggtgctggcggcgacgcggttgctgcggggctcgggttcttggggctgttcgcggctgaggtttggacctcctgcgtacagacggtttagtagtggtggtgcctatcccaacatccccctctcttctcccttacctggagtacccaagcctgtttttgctacagttgatggacaggaaaagtttgaaaccaaagtaaccacattggataatgggcttcgcgtggcatctcagaataagtttggacagttttgtacagtaggaattcttatcaattcaggatcgagatatgaagcgaaataccttagtggaattgctcactttttggaaaaattggcattttcgtctactgctcgatttgacagcaaagatgaaattctgcttacgttggaaaagcatgggggtatctgtgactgccagacatcaagagacaccaccatgtatgctgtgtctgctgatagcaaaggcttggacacggtggttgccttactggctgatgtggttctgcagccccggctaacagatgaagaagtcgagatgacgcggatggcggtccagtttgagctggaggacctgaacctgcggcctgacccagagccacttctcaccgagatgattcatgaagcggcttacagggagaacacagttggcctccaccgtttctgccccacagaaaacgtagcaaagatcaaccgagaggtgctgcattcctacctgaggaactactacactcccgaccgcatggtgctggccggcgtgggcgtggagcacgagcatctggtggactgtgcccggaagtacctcctgggggtccagccggcctgggggagcgcagaggccgtggatattgacagatctgtggcccagtacactggggggattgccaagctagaaagagacatgtccaatgtcagcctgggcccgacccccatccccgagctcacgcacatcatggttggactggagagctgctccttcctggaggaggacttcatcccctttgcagtgttgaacatgatgatgggcggaggtggctccttctcggctggtgggcccggcaagggcatgttctccaggctctacctcaacgtgctcaacaggcaccactggatgtataacgcgacctcctaccaccacagctacgaggacactggcctcctttgcatccatgccagcgccgacccaagacaggttcgagaaatggtagaaatcatcacaaaggagtttattttaatgggcggaaccgtggacacggtggagctggaacgagccaagacgcagctgacatcaatgctcatgatgaacctggaatccaggcctgtgatcttcgaggatgtggggaggcaggtgctggccactcgctccagaaagctgccgcacgagctgtgcacgctcatccgcaacgtgaagccggaagatgtgaagagagtcgcttctaagatgctccgagggaagccggcagtggccgccctgggtgacctgactgacctgcccacgtatgagcacatccagaccgccctgtcgagtaaggacgggcgcctgcccaggacgtaccggctcttccggtag
Sequence Length
1578
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,866 Da
NCBI Official Full Name
Homo sapiens peptidase (mitochondrial processing) alpha, mRNA
NCBI Official Synonym Full Names
peptidase, mitochondrial processing alpha subunit
NCBI Official Symbol
PMPCA
NCBI Official Synonym Symbols
P-55; SCAR2; INPP5E; Alpha-MPP
NCBI Protein Information
mitochondrial-processing peptidase subunit alpha
UniProt Protein Name
Mitochondrial-processing peptidase subunit alpha
Protein Family
UniProt Gene Name
PMPCA
UniProt Synonym Gene Names
INPP5E; KIAA0123; MPPA
UniProt Entry Name
MPPA_HUMAN
NCBI Description
The protein encoded by this gene is found in the mitochondrion, where it represents the alpha subunit of a proteolytic heterodimer. This heterodimer is responsible for cleaving the transit peptide from nuclear-encoded mitochondrial proteins. Defects in this gene are a cause of spinocerebellar ataxia, autosomal recessive 2. [provided by RefSeq, Mar 2016]
Uniprot Description
PMPCA: Cleaves presequences (transit peptides) from mitochondrial protein precursors. Belongs to the peptidase M16 family.
Protein type: Protease; Mitochondrial; EC 3.4.24.64
Chromosomal Location of Human Ortholog: 9q34.3
Cellular Component: extracellular space; mitochondrial inner membrane; mitochondrion
Molecular Function: metalloendopeptidase activity; zinc ion binding
Biological Process: mitochondrial protein processing; proteolysis
Disease: Spinocerebellar Ataxia, Autosomal Recessive 2
Research Articles on PMPCA
Similar Products
Product Notes
The PMPCA pmpca (Catalog #AAA1273304) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctg tggtgctggc ggcgacgcgg ttgctgcggg gctcgggttc ttggggctgt tcgcggctga ggtttggacc tcctgcgtac agacggttta gtagtggtgg tgcctatccc aacatccccc tctcttctcc cttacctgga gtacccaagc ctgtttttgc tacagttgat ggacaggaaa agtttgaaac caaagtaacc acattggata atgggcttcg cgtggcatct cagaataagt ttggacagtt ttgtacagta ggaattctta tcaattcagg atcgagatat gaagcgaaat accttagtgg aattgctcac tttttggaaa aattggcatt ttcgtctact gctcgatttg acagcaaaga tgaaattctg cttacgttgg aaaagcatgg gggtatctgt gactgccaga catcaagaga caccaccatg tatgctgtgt ctgctgatag caaaggcttg gacacggtgg ttgccttact ggctgatgtg gttctgcagc cccggctaac agatgaagaa gtcgagatga cgcggatggc ggtccagttt gagctggagg acctgaacct gcggcctgac ccagagccac ttctcaccga gatgattcat gaagcggctt acagggagaa cacagttggc ctccaccgtt tctgccccac agaaaacgta gcaaagatca accgagaggt gctgcattcc tacctgagga actactacac tcccgaccgc atggtgctgg ccggcgtggg cgtggagcac gagcatctgg tggactgtgc ccggaagtac ctcctggggg tccagccggc ctgggggagc gcagaggccg tggatattga cagatctgtg gcccagtaca ctggggggat tgccaagcta gaaagagaca tgtccaatgt cagcctgggc ccgaccccca tccccgagct cacgcacatc atggttggac tggagagctg ctccttcctg gaggaggact tcatcccctt tgcagtgttg aacatgatga tgggcggagg tggctccttc tcggctggtg ggcccggcaa gggcatgttc tccaggctct acctcaacgt gctcaacagg caccactgga tgtataacgc gacctcctac caccacagct acgaggacac tggcctcctt tgcatccatg ccagcgccga cccaagacag gttcgagaaa tggtagaaat catcacaaag gagtttattt taatgggcgg aaccgtggac acggtggagc tggaacgagc caagacgcag ctgacatcaa tgctcatgat gaacctggaa tccaggcctg tgatcttcga ggatgtgggg aggcaggtgc tggccactcg ctccagaaag ctgccgcacg agctgtgcac gctcatccgc aacgtgaagc cggaagatgt gaagagagtc gcttctaaga tgctccgagg gaagccggca gtggccgccc tgggtgacct gactgacctg cccacgtatg agcacatcca gaccgccctg tcgagtaagg acgggcgcct gcccaggacg taccggctct tccggtag. It is sometimes possible for the material contained within the vial of "PMPCA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
