Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRL cdna clone

PRL cDNA Clone

Gene Names
PRL; GHA1
Synonyms
PRL; PRL cDNA Clone; PRL cdna clone
Ordering
For Research Use Only!
Sequence
atgaacatcaaaggatcgccatggaaagggtccctcctgctgctgctggtgtcaaacctgctcctgtgccagagcgtggcccccttgcccatctgtcccggcggggctgcccgatgccaggtgacccttcgagacctgtttgaccgcgccgtcgtcctgtcccactacatccataacctctcctcagaaatgttcagcgaattcgataaacggtatacccatggccgggggttcattaccaaggccatcaacagctgccacacttcttcccttgccacccccgaagacaaggagcaagcccaacagatgaatcaaaaagactttctgagcctgatagtcagcatattgcgatcctggaatgagcctctgtatcatctggtcacggaagtacgtggtatgcaagaagccccggaggctatcctatccaaagctgtagagattgaggagcaaaccaaacggcttctagagggcatggagctgatagtcagccaggttcatcctgaaaccaaagaaaatgagatctaccctgtctggtcgggacttccatccctgcagatggctgatgaagagtctcgcctttctgcttattataacctgctccactgcctacgcagggattcacataaaatcgacaattatctcaagctcctgaagtgccgaatcatccacaacaacaactgctaa
Sequence Length
684
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,876 Da
NCBI Official Full Name
Homo sapiens prolactin, mRNA
NCBI Official Synonym Full Names
prolactin
NCBI Official Symbol
PRL
NCBI Official Synonym Symbols
GHA1
NCBI Protein Information
prolactin
UniProt Protein Name
Prolactin
UniProt Gene Name
PRL
UniProt Synonym Gene Names
PRL
UniProt Entry Name
PRL_HUMAN

NCBI Description

This gene encodes the anterior pituitary hormone prolactin. This secreted hormone is a growth regulator for many tissues, including cells of the immune system. It may also play a role in cell survival by suppressing apoptosis, and it is essential for lactation. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Aug 2011]

Uniprot Description

prolactin: Prolactin acts primarily on the mammary gland by promoting lactation. Belongs to the somatotropin/prolactin family.

Protein type: Secreted, signal peptide; Motility/polarity/chemotaxis; Secreted; Cytokine

Chromosomal Location of Human Ortholog: 6p22.3

Cellular Component: extracellular region

Molecular Function: prolactin receptor binding; protein binding

Biological Process: cell proliferation; cell surface receptor linked signal transduction; cellular protein metabolic process; positive regulation of JAK-STAT cascade; regulation of multicellular organism growth

Research Articles on PRL

Similar Products

Product Notes

The PRL prl (Catalog #AAA1273232) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacatca aaggatcgcc atggaaaggg tccctcctgc tgctgctggt gtcaaacctg ctcctgtgcc agagcgtggc ccccttgccc atctgtcccg gcggggctgc ccgatgccag gtgacccttc gagacctgtt tgaccgcgcc gtcgtcctgt cccactacat ccataacctc tcctcagaaa tgttcagcga attcgataaa cggtataccc atggccgggg gttcattacc aaggccatca acagctgcca cacttcttcc cttgccaccc ccgaagacaa ggagcaagcc caacagatga atcaaaaaga ctttctgagc ctgatagtca gcatattgcg atcctggaat gagcctctgt atcatctggt cacggaagta cgtggtatgc aagaagcccc ggaggctatc ctatccaaag ctgtagagat tgaggagcaa accaaacggc ttctagaggg catggagctg atagtcagcc aggttcatcc tgaaaccaaa gaaaatgaga tctaccctgt ctggtcggga cttccatccc tgcagatggc tgatgaagag tctcgccttt ctgcttatta taacctgctc cactgcctac gcagggattc acataaaatc gacaattatc tcaagctcct gaagtgccga atcatccaca acaacaactg ctaa. It is sometimes possible for the material contained within the vial of "PRL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.