Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNRPF cdna clone

SNRPF cDNA Clone

Gene Names
SNRPF; SMF; Sm-F; snRNP-F
Synonyms
SNRPF; SNRPF cDNA Clone; SNRPF cdna clone
Ordering
For Research Use Only!
Sequence
ATGAGTTTACCCCTCAATCCCAAACCTTTCCTCAATGGACTAACAGGAAAGCCAGTGATGGTGAAACTTAAGTGGGGAATGGAGTACAAGGGCTATCTGGTATCTGTAGATGGCTACATGAACATGCAGCTTGCAAATACAGAAGAATACATAGATGGAGCTTTGTCTGGACATCTGGGTGAAGTTTTAATAAGGTGTAATAATGTCCTTTATATCAGAGGTGTGGAAGAAGAGGAAGAAGATGGGGAAATGAGAGAATAG
Sequence Length
261
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,725 Da
NCBI Official Full Name
Homo sapiens small nuclear ribonucleoprotein polypeptide F, mRNA
NCBI Official Synonym Full Names
small nuclear ribonucleoprotein polypeptide F
NCBI Official Symbol
SNRPF
NCBI Official Synonym Symbols
SMF; Sm-F; snRNP-F
NCBI Protein Information
small nuclear ribonucleoprotein F
UniProt Protein Name
Small nuclear ribonucleoprotein F
UniProt Gene Name
SNRPF
UniProt Synonym Gene Names
PBSCF; snRNP-F; Sm-F; SmF
UniProt Entry Name
RUXF_HUMAN

Uniprot Description

snRNP F: Appears to function in the U7 snRNP complex that is involved in histone 3'-end processing. Associated with snRNP U1, U2, U4/U6 and U5. Belongs to the snRNP Sm proteins family. SmF/LSm6 subfamily.

Protein type: Spliceosome; Motility/polarity/chemotaxis; RNA splicing

Chromosomal Location of Human Ortholog: 12q23.1

Cellular Component: cytosol; nucleoplasm; small nuclear ribonucleoprotein complex; snRNP U1; spliceosome; U12-dependent spliceosome

Molecular Function: protein binding; RNA binding

Biological Process: histone mRNA metabolic process; nuclear import; nuclear mRNA splicing, via spliceosome; RNA splicing; spliceosomal snRNP biogenesis; termination of RNA polymerase II transcription

Similar Products

Product Notes

The SNRPF snrpf (Catalog #AAA1273129) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAGTTTAC CCCTCAATCC CAAACCTTTC CTCAATGGAC TAACAGGAAA GCCAGTGATG GTGAAACTTA AGTGGGGAAT GGAGTACAAG GGCTATCTGG TATCTGTAGA TGGCTACATG AACATGCAGC TTGCAAATAC AGAAGAATAC ATAGATGGAG CTTTGTCTGG ACATCTGGGT GAAGTTTTAA TAAGGTGTAA TAATGTCCTT TATATCAGAG GTGTGGAAGA AGAGGAAGAA GATGGGGAAA TGAGAGAATA G. It is sometimes possible for the material contained within the vial of "SNRPF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.