Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SORBS3 cdna clone

SORBS3 cDNA Clone

Gene Names
SORBS3; SCAM1; SH3D4; SCAM-1
Synonyms
SORBS3; SORBS3 cDNA Clone; SORBS3 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgatggaggaagccccttcctaggtcggagggactttgtctacccttcctcaacccgagaccctagtgcctctaacggagggggcagcccagccaggagggaagagaagaagagaaaggccgccaggctcaagtttgacttccaggcgcagtcccccaaggagctgactctgcagaagggtgacattgtctacatccacaaggaggtggacaagaactggctggagggagagcaccacggccgcctgggcatcttccctgctaattatgtggaggtgctgcccgcagatgagatccctaagcccatcaagcccccgacctaccaggtgctggagtatggagaggctgtggcccagtacaccttcaagggggacctggaggtggagctgtccttccgcaagggagagcacatctgcctgatccgcaaggtgaacgagaactggtacgagggacgcatcacgggcacggggcgccaaggcatattccctgccagctacgtgcaggtgtctcgtgaaccccggctccggctctgtgacgacggcccccagctccccacgtctccccgcctgaccgctgccgcccgctcagcccgtcaccccagctccccctcagccctgcgcagcccagctgaccccatcgacttggggggacagacctccccccgtcgcactggcttctccttccccacccaggagcctagaccccagacccagaatcttggcacccctggtccagctctgtcccactctcgaggtcccagccatcccctggacctggggacctcctctcctaacacctctcagatacactggaccccgtaccgggcgatgtaccagtacaggccccagaacgaagacgagctggagctgcgcgagggggacagggtggatgtcatgcagcagtgtgacgatggctggtttgtgggtgtctcccggaggacccagaaattcggaacgttccctggaaattacgttgccccggtgtga
Sequence Length
990
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,742 Da
NCBI Official Full Name
Homo sapiens sorbin and SH3 domain containing 3, mRNA
NCBI Official Synonym Full Names
sorbin and SH3 domain containing 3
NCBI Official Symbol
SORBS3
NCBI Official Synonym Symbols
SCAM1; SH3D4; SCAM-1
NCBI Protein Information
vinexin
UniProt Protein Name
Vinexin
Protein Family
UniProt Gene Name
SORBS3
UniProt Synonym Gene Names
SCAM1; SCAM-1
UniProt Entry Name
VINEX_HUMAN

NCBI Description

This gene encodes an SH3 domain-containing adaptor protein. The presence of SH3 domains play a role in this protein's ability to bind other cytoplasmic molecules and contribute to cystoskeletal organization, cell adhesion and migration, signaling, and gene expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]

Uniprot Description

vinexin: an adapter protein that contains three SH3 domains and is involved in the reorganization of actin cytoskeleton. Two alternatively spliced isoforms have been described. Vinexin alpha isoform promotes up-regulation of actin stress fiber formation. Vinexin beta isoform plays a role in cell spreading and enhances the activation of JNK/SAPK in response to EGF stimulation by using its third SH3 domain. Both isoforms localize at focal adhesion and cell-cell adhesion sites; vinexin beta was also found in the nucleus. Interacts with DLG5 through its third SH3 domain. Interacts with vinculin by the first two SH3 domains and the proline rich region of vinculin. Binds to SOS (guanine nucleotide exchange factor of RAS and RAC) through its third SH3 domain. The formation of this complex is down-regulated by phosphorylation of SOS. Interacts with SAFB2.

Protein type: Nuclear receptor co-regulator; Motility/polarity/chemotaxis; Cell adhesion; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 8p21.3

Cellular Component: cytosol; focal adhesion

Molecular Function: protein binding; structural constituent of cytoskeleton; vinculin binding

Biological Process: cell adhesion; muscle contraction; positive regulation of stress fiber formation

Research Articles on SORBS3

Similar Products

Product Notes

The SORBS3 sorbs3 (Catalog #AAA1273058) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgatg gaggaagccc cttcctaggt cggagggact ttgtctaccc ttcctcaacc cgagacccta gtgcctctaa cggagggggc agcccagcca ggagggaaga gaagaagaga aaggccgcca ggctcaagtt tgacttccag gcgcagtccc ccaaggagct gactctgcag aagggtgaca ttgtctacat ccacaaggag gtggacaaga actggctgga gggagagcac cacggccgcc tgggcatctt ccctgctaat tatgtggagg tgctgcccgc agatgagatc cctaagccca tcaagccccc gacctaccag gtgctggagt atggagaggc tgtggcccag tacaccttca agggggacct ggaggtggag ctgtccttcc gcaagggaga gcacatctgc ctgatccgca aggtgaacga gaactggtac gagggacgca tcacgggcac ggggcgccaa ggcatattcc ctgccagcta cgtgcaggtg tctcgtgaac cccggctccg gctctgtgac gacggccccc agctccccac gtctccccgc ctgaccgctg ccgcccgctc agcccgtcac cccagctccc cctcagccct gcgcagccca gctgacccca tcgacttggg gggacagacc tccccccgtc gcactggctt ctccttcccc acccaggagc ctagacccca gacccagaat cttggcaccc ctggtccagc tctgtcccac tctcgaggtc ccagccatcc cctggacctg gggacctcct ctcctaacac ctctcagata cactggaccc cgtaccgggc gatgtaccag tacaggcccc agaacgaaga cgagctggag ctgcgcgagg gggacagggt ggatgtcatg cagcagtgtg acgatggctg gtttgtgggt gtctcccgga ggacccagaa attcggaacg ttccctggaa attacgttgc cccggtgtga. It is sometimes possible for the material contained within the vial of "SORBS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.