Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RHOG cdna clone

RHOG cDNA Clone

Gene Names
RHOG; ARHG
Synonyms
RHOG; RHOG cDNA Clone; RHOG cdna clone
Ordering
For Research Use Only!
Sequence
ATGCAGAGCATCAAGTGCGTGGTGGTGGGTGATGGGGCTGTGGGCAAGACGTGCCTGCTCATCTGCTACACAACTAACGCTTTCCCCAAAGAGTACATCCCCACCGTGTTCGACAATTACAGCGCGCAGAGCGCAGTTGACGGGCGCACAGTGAACCTGAACCTGTGGGACACTGCGGGCCAGGAGGAGTATGACCGCCTCCGTACACTCTCCTACCCTCAGACCAACGTTTTCGTCATCTGTTTCTCCATTGCCAGTCCGCCGTCCTATGAGAACGTGCGGCACAAGTGGCATCCAGAGGTGTGCCACCACTGCCCTGATGTGCCCATCCTGCTGGTGGGCACCAAGAAGGACCTGAGAGCCCAGCCTGACACCCTACGGCGCCTCAAGGAGCAGGGCCAGGCGCCCATCACACCGCAGCAGGGCCAGGCACTGGCCAAGCAGATCCACGCTGTGCGCTACCTCGAATGCTCAGCCCTGCAACAGGATGGTGTCAAGGAAGTGTTCGCCGAGGCTGTCCGGGCTGTGCTCAACCCCACGCCGATCAAGCGTGGGCGGTCCTGCATCCTCTTGTGA
Sequence Length
576
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
391
Molecular Weight
21,309 Da
NCBI Official Full Name
Homo sapiens ras homolog gene family, member G (rho G), mRNA
NCBI Official Synonym Full Names
ras homolog family member G
NCBI Official Symbol
RHOG
NCBI Official Synonym Symbols
ARHG
NCBI Protein Information
rho-related GTP-binding protein RhoG
UniProt Protein Name
Rho-related GTP-binding protein RhoG
UniProt Gene Name
RHOG
UniProt Synonym Gene Names
ARHG
UniProt Entry Name
RHOG_HUMAN

NCBI Description

This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The encoded protein facilitates translocation of a functional guanine nucleotide exchange factor (GEF) complex from the cytoplasm to the plasma membrane where ras-related C3 botulinum toxin substrate 1 is activated to promote lamellipodium formation and cell migration. Two related pseudogene have been identified on chromosomes 20 and X. [provided by RefSeq, Aug 2011]

Uniprot Description

RHOG: Required for the formation of membrane ruffles during macropinocytosis. Plays a role in cell migration and is required for the formation of cup-like structures during trans-endothelial migration of leukocytes. In case of Salmonella enterica infection, activated by SopB and ARHGEF26/SGEF, which induces cytoskeleton rearrangements and promotes bacterial entry. Belongs to the small GTPase superfamily. Rho family.

Protein type: G protein, monomeric, Rho; Motility/polarity/chemotaxis; G protein, monomeric

Chromosomal Location of Human Ortholog: 11p15.5-p15.4

Cellular Component: cytosol; endoplasmic reticulum membrane; focal adhesion; plasma membrane

Molecular Function: GTPase activity; protein binding

Biological Process: actin cytoskeleton organization and biogenesis; platelet activation; positive regulation of cell proliferation; positive regulation of transcription, DNA-dependent; Rac protein signal transduction; regulation of small GTPase mediated signal transduction; Rho protein signal transduction

Research Articles on RHOG

Similar Products

Product Notes

The RHOG rhog (Catalog #AAA1273012) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCAGAGCA TCAAGTGCGT GGTGGTGGGT GATGGGGCTG TGGGCAAGAC GTGCCTGCTC ATCTGCTACA CAACTAACGC TTTCCCCAAA GAGTACATCC CCACCGTGTT CGACAATTAC AGCGCGCAGA GCGCAGTTGA CGGGCGCACA GTGAACCTGA ACCTGTGGGA CACTGCGGGC CAGGAGGAGT ATGACCGCCT CCGTACACTC TCCTACCCTC AGACCAACGT TTTCGTCATC TGTTTCTCCA TTGCCAGTCC GCCGTCCTAT GAGAACGTGC GGCACAAGTG GCATCCAGAG GTGTGCCACC ACTGCCCTGA TGTGCCCATC CTGCTGGTGG GCACCAAGAA GGACCTGAGA GCCCAGCCTG ACACCCTACG GCGCCTCAAG GAGCAGGGCC AGGCGCCCAT CACACCGCAG CAGGGCCAGG CACTGGCCAA GCAGATCCAC GCTGTGCGCT ACCTCGAATG CTCAGCCCTG CAACAGGATG GTGTCAAGGA AGTGTTCGCC GAGGCTGTCC GGGCTGTGCT CAACCCCACG CCGATCAAGC GTGGGCGGTC CTGCATCCTC TTGTGA. It is sometimes possible for the material contained within the vial of "RHOG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.