Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLK3 cdna clone

CLK3 cDNA Clone

Gene Names
CLK3; PHCLK3; PHCLK3/152
Synonyms
CLK3; CLK3 cDNA Clone; CLK3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcatcactgtaagcgataccgctcccctgaaccagacccgtacctgagctaccgatggaagaggaggaggtcctacagtcgggaacatgaagggagactgcgatacccgtcccgaagggagcctcccccacgaagatctcggtccagaagccatgaccgcctgccctaccagaggaggtaccgggagcgccgtgacagcgatacataccggtgtgaagagcggagcccatcctttggagaggactactatggaccttcacgttctcgtcatcgtcggcgatcgcgggagagggggccataccggacccgcaagcatgcccaccactgccacaaacgccgcaccaggtcttgtagcagcgcctcctcgagaagccaacagagcagtaagcgcagcagccggagtgtggaagatgacaaggagggtcacctggtgtgccggatcggcgattggctccaagagcgatatgagattgtggggaacctgggtgaaggcacctttggcaaggtggtggagtgcttggaccatgccagagggaagtctcaggttgccctgaagatcatccgcaacgtgggcaagtaccgggaggctgcccggctagaaatcaacgtgctcaaaaaaatcaaggagaaggacaaagaaaacaagttcctgtgtgtcttgatgtctgactggttcaacttccacggtcacatgtgcatcgcctttgagctcctgggcaagaacacctttgagttcctgaaggagaataacttccagccttaccccctaccacatgtccggcacatggcctaccagctctgccacgcccttagatttctgcatgagaatcagctgacccatacagacttgaaaccagagaacatcctgtttgtgaattctgagtttgaaaccctctacaatgagcacaagagctgtgaggagaagtcagtgaagaacaccagcatccgagtggctgactttggcagtgccacatttgaccatgagcaccacaccaccattgtggccacccgtcactatcgcccgcctgaggtgatccttgagctgggctgggcacagccctgtgacgtctggagcattggctgcattctctttgagtactaccggggcttcacactcttccagacccacgaaaaccgagagcacctggtgatgatggagaagatcctagggcccatcccatcacacatgatccaccgtaccaggaagcagaaatatttctacaaagggggcctagtttgggatgagaacagctctgacggccggtatgtgaaggagaactgcaaacctctgaagagttacatgctccaagactccctggagcacgtgcagctgtttgacctgatgaggaggatgttagaatttgaccctgcccagcgcatcacactggccgaggccctgctgcaccccttctttgctggcttgacccctgaggagcggtccttccacaccagccgcaacccaagcagatga
Sequence Length
1473
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,207 Da
NCBI Official Full Name
Homo sapiens CDC-like kinase 3, mRNA
NCBI Official Synonym Full Names
CDC like kinase 3
NCBI Official Symbol
CLK3
NCBI Official Synonym Symbols
PHCLK3; PHCLK3/152
NCBI Protein Information
dual specificity protein kinase CLK3
UniProt Protein Name
Dual specificity protein kinase CLK3
UniProt Gene Name
CLK3
UniProt Entry Name
CLK3_HUMAN

NCBI Description

This gene encodes a protein belonging to the serine/threonine type protein kinase family. This protein is a nuclear dual-specificity kinase that regulates the intranuclear distribution of the serine/arginine-rich (SR) family of splicing factors. Two transcript variants encoding different isoforms have been found for this gene. Related pseudogenes are located on chromosomes 1 and 9. [provided by RefSeq, Jul 2008]

Uniprot Description

CLK3: a CMGC kinase of the CLK family. Phosphorylates serine- and arginine-rich (SR) proteins of the spliceosomal complex. May play a role in regulating RNA splicing. Three alternatively spliced isoforms have been described. Isoform 2 is short and lacks the kinase domain. May be produced at very low levels due to a premature stop codon in the mRNA, leading to nonsense-mediated mRNA decay.

Protein type: Protein kinase, dual-specificity (non-receptor); Kinase, protein; EC 2.7.12.1; Protein kinase, CMGC; CMGC group; CLK family

Chromosomal Location of Human Ortholog: 15q24

Cellular Component: intermediate filament cytoskeleton; membrane; nucleoplasm; nucleus

Molecular Function: protein binding; protein serine/threonine kinase activity

Biological Process: protein amino acid phosphorylation; regulation of RNA splicing

Research Articles on CLK3

Similar Products

Product Notes

The CLK3 clk3 (Catalog #AAA1272987) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatcact gtaagcgata ccgctcccct gaaccagacc cgtacctgag ctaccgatgg aagaggagga ggtcctacag tcgggaacat gaagggagac tgcgataccc gtcccgaagg gagcctcccc cacgaagatc tcggtccaga agccatgacc gcctgcccta ccagaggagg taccgggagc gccgtgacag cgatacatac cggtgtgaag agcggagccc atcctttgga gaggactact atggaccttc acgttctcgt catcgtcggc gatcgcggga gagggggcca taccggaccc gcaagcatgc ccaccactgc cacaaacgcc gcaccaggtc ttgtagcagc gcctcctcga gaagccaaca gagcagtaag cgcagcagcc ggagtgtgga agatgacaag gagggtcacc tggtgtgccg gatcggcgat tggctccaag agcgatatga gattgtgggg aacctgggtg aaggcacctt tggcaaggtg gtggagtgct tggaccatgc cagagggaag tctcaggttg ccctgaagat catccgcaac gtgggcaagt accgggaggc tgcccggcta gaaatcaacg tgctcaaaaa aatcaaggag aaggacaaag aaaacaagtt cctgtgtgtc ttgatgtctg actggttcaa cttccacggt cacatgtgca tcgcctttga gctcctgggc aagaacacct ttgagttcct gaaggagaat aacttccagc cttaccccct accacatgtc cggcacatgg cctaccagct ctgccacgcc cttagatttc tgcatgagaa tcagctgacc catacagact tgaaaccaga gaacatcctg tttgtgaatt ctgagtttga aaccctctac aatgagcaca agagctgtga ggagaagtca gtgaagaaca ccagcatccg agtggctgac tttggcagtg ccacatttga ccatgagcac cacaccacca ttgtggccac ccgtcactat cgcccgcctg aggtgatcct tgagctgggc tgggcacagc cctgtgacgt ctggagcatt ggctgcattc tctttgagta ctaccggggc ttcacactct tccagaccca cgaaaaccga gagcacctgg tgatgatgga gaagatccta gggcccatcc catcacacat gatccaccgt accaggaagc agaaatattt ctacaaaggg ggcctagttt gggatgagaa cagctctgac ggccggtatg tgaaggagaa ctgcaaacct ctgaagagtt acatgctcca agactccctg gagcacgtgc agctgtttga cctgatgagg aggatgttag aatttgaccc tgcccagcgc atcacactgg ccgaggccct gctgcacccc ttctttgctg gcttgacccc tgaggagcgg tccttccaca ccagccgcaa cccaagcaga tga. It is sometimes possible for the material contained within the vial of "CLK3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.