Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KDELC1 cdna clone

KDELC1 cDNA Clone

Gene Names
KDELC1; EP58; ERp58; KDEL1
Synonyms
KDELC1; KDELC1 cDNA Clone; KDELC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttggcactttgctactttattgcttctttctggcgacagttccagcactcgccgagaccggcggagaaaggcagctgagcccggagaagagcgaaatatggggacccgggctaaaagcagacgtcgtccttcccgcccgctatttctatattcaggcagtggatacatcagggaataaattcacatcttctccaggcgaaaaggtcttccaggtgaaagtctcagcaccagaggagcaattcactagagttggagtccaggttttagaccgaaaagatgggtccttcatagtaagatacagaatgtatgcaagctacaaaaatctgaaggtggaagttaaattccaagggcaacatgtggccaaatccccatatattttaaaagggccggtttaccatgagaactgtgactgtcctctgcaagatagtgcagcctggctacgggagatgaactgccctgaaaccattgctcagattcagagagatctggcacatttccctgctgtggatccagaaaagattgcagtagaaatcccaaaaagatttggacagaggcagagcctatgtcactacaccttaaaggataacaaggtttatatcaagactcatggtgaacatgtaggttttagaattttcatggatgccatactactttctttgactagaaaggtgaagatgccagatgtggagctctttgttaatttgggagactggcctttggaaaaaaagaaatccaattcaaacatccatccgatcttttcctggtgtggctccacagattccaaggatatcgtgatgcctacgtacgatttgactgattctgttctggaaaccatgggccgggtaagtctggatatgatgtccgtgcaagctaacacgggtcctccctgggaaagcaaaaattccactgccgtctggagagggcgagacagccgcaaagagagactcgagctggttaaactcagtagaaaacacccagaactcatagacgctgctttcaccaactttttcttctttaaacacgatgaaaacctgtatggtcccattgtgaaacatatttcattttttgatttcttcaagcataagtatcaaataaatatcgatggcactgtagcagcttatcgcctgccatatttgctagttggtgacagtgttgtgctgaagcaggattccatctactatgaacatttttacaatgagctgcagccctggaaacactacattccagttaagagcaacctgagcgatctgctagaaaaacttaaatgggcgaaagatcacgatgaagaggccaaaaagatagcaaaagcaggacaagaatttgcaagaaataatctcatgggcgatgacatattctgttattatttcaaacttttccaggaatatgccaatttacaagtgagtgagccccaaatccgagagggcatgaaaagggtagaaccacagactgaggacgacctcttcccttgtacttgccataggaaaaagaccaaagatgaactctga
Sequence Length
1509
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,043 Da
NCBI Official Full Name
Homo sapiens KDEL (Lys-Asp-Glu-Leu) containing 1, mRNA
NCBI Official Synonym Full Names
KDEL motif containing 1
NCBI Official Symbol
KDELC1
NCBI Official Synonym Symbols
EP58; ERp58; KDEL1
NCBI Protein Information
KDEL motif-containing protein 1
UniProt Protein Name
KDEL motif-containing protein 1
UniProt Gene Name
KDELC1
UniProt Synonym Gene Names
EP58; ER protein 58; ERp58
UniProt Entry Name
KDEL1_HUMAN

NCBI Description

This gene encodes a protein product localized to the lumen of the endoplasmic reticulum. As a member of the endoplasmic reticulum protein family the encoded protein contains a Lys-Asp-Glu-Leu or KDEL motif located at the extreme C-terminus which prevents all endoplasmic reticulum resident proteins from being secreted. Proteins carrying this motif are bound by a receptor in the Golgi apparatus so that the receptor-ligand complex returns to the endoplasmic reticulum. A processed non-transcribed pseudogene located in an intron of a sodium transporter gene on chromosome 5 has been defined for this gene. This gene has multiple transcript variants which are predicted to encode distinct isoforms. [provided by RefSeq, Jan 2016]

Uniprot Description

KDELC1: a protein product localized to the lumen of the endoplasmic reticulum. As a member of the endoplasmic reticulum protein family the encoded protein contains a Lys-Asp-Glu-Leu or KDEL motif located at the extreme C-terminus which prevents all endoplasmic reticulum resident proteins from being secreted. Proteins carrying this motif are bound by a receptor in the Golgi apparatus so that the receptor-ligand complex returns to the endoplasmic reticulum. A processed non-transcribed pseudogene located in an intron of a sodium transporter gene on chromosome 5 has been defined for this gene. [provided by RefSeq, Jul 2008]

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 13q33

Cellular Component: endoplasmic reticulum lumen

Molecular Function: glucosyltransferase activity

Biological Process: glycolipid metabolic process

Research Articles on KDELC1

Similar Products

Product Notes

The KDELC1 kdelc1 (Catalog #AAA1272963) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttggca ctttgctact ttattgcttc tttctggcga cagttccagc actcgccgag accggcggag aaaggcagct gagcccggag aagagcgaaa tatggggacc cgggctaaaa gcagacgtcg tccttcccgc ccgctatttc tatattcagg cagtggatac atcagggaat aaattcacat cttctccagg cgaaaaggtc ttccaggtga aagtctcagc accagaggag caattcacta gagttggagt ccaggtttta gaccgaaaag atgggtcctt catagtaaga tacagaatgt atgcaagcta caaaaatctg aaggtggaag ttaaattcca agggcaacat gtggccaaat ccccatatat tttaaaaggg ccggtttacc atgagaactg tgactgtcct ctgcaagata gtgcagcctg gctacgggag atgaactgcc ctgaaaccat tgctcagatt cagagagatc tggcacattt ccctgctgtg gatccagaaa agattgcagt agaaatccca aaaagatttg gacagaggca gagcctatgt cactacacct taaaggataa caaggtttat atcaagactc atggtgaaca tgtaggtttt agaattttca tggatgccat actactttct ttgactagaa aggtgaagat gccagatgtg gagctctttg ttaatttggg agactggcct ttggaaaaaa agaaatccaa ttcaaacatc catccgatct tttcctggtg tggctccaca gattccaagg atatcgtgat gcctacgtac gatttgactg attctgttct ggaaaccatg ggccgggtaa gtctggatat gatgtccgtg caagctaaca cgggtcctcc ctgggaaagc aaaaattcca ctgccgtctg gagagggcga gacagccgca aagagagact cgagctggtt aaactcagta gaaaacaccc agaactcata gacgctgctt tcaccaactt tttcttcttt aaacacgatg aaaacctgta tggtcccatt gtgaaacata tttcattttt tgatttcttc aagcataagt atcaaataaa tatcgatggc actgtagcag cttatcgcct gccatatttg ctagttggtg acagtgttgt gctgaagcag gattccatct actatgaaca tttttacaat gagctgcagc cctggaaaca ctacattcca gttaagagca acctgagcga tctgctagaa aaacttaaat gggcgaaaga tcacgatgaa gaggccaaaa agatagcaaa agcaggacaa gaatttgcaa gaaataatct catgggcgat gacatattct gttattattt caaacttttc caggaatatg ccaatttaca agtgagtgag ccccaaatcc gagagggcat gaaaagggta gaaccacaga ctgaggacga cctcttccct tgtacttgcc ataggaaaaa gaccaaagat gaactctga. It is sometimes possible for the material contained within the vial of "KDELC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.