Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STYX cdna clone

STYX cDNA Clone

Synonyms
STYX; STYX cDNA Clone; STYX cdna clone
Ordering
For Research Use Only!
Sequence
atggaggacgtgaagctggagttcccttcccttccacagtgcaaggaagacgccgaggagtggacctaccctatgagacgagagatgcaggaaattttacctggattgttcttaggcccatattcatctgctatgaaaagcaagctacctgtactacagaaacatggaataacccatataatatgcatacgacaaaatattgaagcaaactttattaaaccaaactttcagcagttatttagatatttagtcctggatattgcagataatccagttgaaaatataatacgttttttccctatgactaaggaatttattgatgggagcttacaaatgggaggaaaagttcttgtgcatggaaatgcagggatctccagaagtgcagcctttgttattgcatacattatggaaacatttggaatgaagtacagagatgcttttgcttatgttcaagaaagaagattttgtattaatcctaatgctggatttgtccatcaacttcaggaatatgaagccatctacctagcaaaattaacaatacagatgatgtcaccactccagatagaaaggtcattatctgttcattctggtaccacaggcagtttgaagagaacacatgaagaagaggatgattttggaaccatgcaagtggcgactgcacagaatggctga
Sequence Length
672
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,492 Da
NCBI Official Full Name
Homo sapiens serine/threonine/tyrosine interacting protein, mRNA
NCBI Official Synonym Full Names
serine/threonine/tyrosine interacting protein
NCBI Official Symbol
STYX
NCBI Protein Information
serine/threonine/tyrosine-interacting protein
UniProt Protein Name
Serine/threonine/tyrosine-interacting protein
UniProt Gene Name
STYX
UniProt Entry Name
STYX_HUMAN

NCBI Description

The protein encoded by this gene is a pseudophosphatase, able to bind potential substrates but lacking an active catalytic loop. The encoded protein may be involved in spermiogenesis. Two transcript variants encoding the same protein have been found for these genes. [provided by RefSeq, Oct 2011]

Uniprot Description

STYX: Probable pseudophosphatase. Contains a Gly residue instead of a conserved Cys residue in the dsPTPase catalytic loop which renders it catalytically inactive as a phosphatase. The binding pocket is however sufficiently preserved to bind phosphorylated substrates, and maybe protect them from phosphatases. Seems to play a role in spermiogenesis. Belongs to the protein-tyrosine phosphatase family. Non-receptor class subfamily.

Protein type: Protein phosphatase, tyrosine (non-receptor); Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: -

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding

Biological Process: MAPK export from nucleus; spermatogenesis

Research Articles on STYX

Similar Products

Product Notes

The STYX styx (Catalog #AAA1272878) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggacg tgaagctgga gttcccttcc cttccacagt gcaaggaaga cgccgaggag tggacctacc ctatgagacg agagatgcag gaaattttac ctggattgtt cttaggccca tattcatctg ctatgaaaag caagctacct gtactacaga aacatggaat aacccatata atatgcatac gacaaaatat tgaagcaaac tttattaaac caaactttca gcagttattt agatatttag tcctggatat tgcagataat ccagttgaaa atataatacg ttttttccct atgactaagg aatttattga tgggagctta caaatgggag gaaaagttct tgtgcatgga aatgcaggga tctccagaag tgcagccttt gttattgcat acattatgga aacatttgga atgaagtaca gagatgcttt tgcttatgtt caagaaagaa gattttgtat taatcctaat gctggatttg tccatcaact tcaggaatat gaagccatct acctagcaaa attaacaata cagatgatgt caccactcca gatagaaagg tcattatctg ttcattctgg taccacaggc agtttgaaga gaacacatga agaagaggat gattttggaa ccatgcaagt ggcgactgca cagaatggct ga. It is sometimes possible for the material contained within the vial of "STYX, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.