Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHF21B cdna clone

PHF21B cDNA Clone

Gene Names
PHF21B; PHF4; BHC80L
Synonyms
PHF21B; PHF21B cDNA Clone; PHF21B cdna clone
Ordering
For Research Use Only!
Sequence
atggagctgcagagccggcccgaggcgctcgccgtggaactcgcgcgccaccagaacggcgacctcaagaagcagctccacgaaaggcagccgcggatcgccgcgctcagcgacaaacaagctttgggaacgatcactgcagtgcctgtcacgggtcctcaggtcagctccttgcagaggttggccgggcaaggagcggcagtgctacctcaggttaggccaaagactctgattccagacagcctccccgttgccccgggccgggaccggccacccaagcagcccccaacattccagaaggccaccgtggtcagcgtcaagaaccccagcccagccctccccaccgccaacaacactgtcagccatgtgccagcgcccggcagccagccccaggccctcgccgagcccgccgccctcgcctctccgctgagcagtgcgggggtggcctacgccatcatctccacctcccccagcaatgccgccgccatggcccccagcaccgccgtgtctgtggtcagtgacagcatcaaagtccagcccctcctcatcagtgctgacaacaagcctcctccacgcctcctctcttcccctcaccccgcaacccatcactgtcccctccacccctcctctcttcccctcacccctccctccccatcactgtccccttcacccctccatggcatcttccaggtcatcatcattcagcctcaagtgcagacgcagcccgagagcacggcagagtcgcggccgcccacagaggagccatctcagggagctcaggccaccaaaaagaagaaggaagaccggcccccgacccaggagaaccccgagaaaatcgccttcatggtagcgctaggcctggttaccacggaacatttggaagaaatccagagcaagcgacaggagcggaagagaagaagcacagccaaccctgcctacagcggcctcctggagaccgagaggaaacggctggcctccaactatctcaacaaccccctgttcctcacagcgagagccaatgaggacccctgctggaagaacgagatcacccacgatgagcactgtgccgcctgcaagcgaggggccaacctgcagccctgcggcacctgcccgggggcctaccacctcagctgcctggagccgcccctcaagacggcgcccaagggcgtgtgggtgtgccccaggtgccagcagaaggccttaaagaaagacgagggtgtgccctggactgggatgctggccatcgtgcactcttatgtcacccacaagacagtcaaagaagaggagaagcagaagctgctgcaacgaggcagtgagctgcagaacgagcaccagcagctggaggagcgggaccggcggctggcgtcagcagtgcagaaatgcctggagttgaagacaagcctgctggcccgccagaggggcacccagtcatccctggaccgcctgcgggccctcctgagactgatacagggcgagcagctgctccaggtcaccatgacgaccactagccctgccccactgctggccgggccctggaccaagccctcagtggcagccacacaccccaccgtccagcacccccagggccacaactga
Sequence Length
1596
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,776 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 21B, mRNA
NCBI Official Synonym Full Names
PHD finger protein 21B
NCBI Official Symbol
PHF21B
NCBI Official Synonym Symbols
PHF4; BHC80L
NCBI Protein Information
PHD finger protein 21B
UniProt Protein Name
PHD finger protein 21B
Protein Family
UniProt Gene Name
PHF21B
UniProt Synonym Gene Names
KIAA1661
UniProt Entry Name
PF21B_HUMAN

Uniprot Description

PHF21B: 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 22q13.31

Cellular Component: nucleus

Molecular Function: chromatin binding; histone binding; transcription cofactor activity

Biological Process: regulation of transcription, DNA-dependent

Research Articles on PHF21B

Similar Products

Product Notes

The PHF21B phf21b (Catalog #AAA1272838) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctgc agagccggcc cgaggcgctc gccgtggaac tcgcgcgcca ccagaacggc gacctcaaga agcagctcca cgaaaggcag ccgcggatcg ccgcgctcag cgacaaacaa gctttgggaa cgatcactgc agtgcctgtc acgggtcctc aggtcagctc cttgcagagg ttggccgggc aaggagcggc agtgctacct caggttaggc caaagactct gattccagac agcctccccg ttgccccggg ccgggaccgg ccacccaagc agcccccaac attccagaag gccaccgtgg tcagcgtcaa gaaccccagc ccagccctcc ccaccgccaa caacactgtc agccatgtgc cagcgcccgg cagccagccc caggccctcg ccgagcccgc cgccctcgcc tctccgctga gcagtgcggg ggtggcctac gccatcatct ccacctcccc cagcaatgcc gccgccatgg cccccagcac cgccgtgtct gtggtcagtg acagcatcaa agtccagccc ctcctcatca gtgctgacaa caagcctcct ccacgcctcc tctcttcccc tcaccccgca acccatcact gtcccctcca cccctcctct cttcccctca cccctccctc cccatcactg tccccttcac ccctccatgg catcttccag gtcatcatca ttcagcctca agtgcagacg cagcccgaga gcacggcaga gtcgcggccg cccacagagg agccatctca gggagctcag gccaccaaaa agaagaagga agaccggccc ccgacccagg agaaccccga gaaaatcgcc ttcatggtag cgctaggcct ggttaccacg gaacatttgg aagaaatcca gagcaagcga caggagcgga agagaagaag cacagccaac cctgcctaca gcggcctcct ggagaccgag aggaaacggc tggcctccaa ctatctcaac aaccccctgt tcctcacagc gagagccaat gaggacccct gctggaagaa cgagatcacc cacgatgagc actgtgccgc ctgcaagcga ggggccaacc tgcagccctg cggcacctgc ccgggggcct accacctcag ctgcctggag ccgcccctca agacggcgcc caagggcgtg tgggtgtgcc ccaggtgcca gcagaaggcc ttaaagaaag acgagggtgt gccctggact gggatgctgg ccatcgtgca ctcttatgtc acccacaaga cagtcaaaga agaggagaag cagaagctgc tgcaacgagg cagtgagctg cagaacgagc accagcagct ggaggagcgg gaccggcggc tggcgtcagc agtgcagaaa tgcctggagt tgaagacaag cctgctggcc cgccagaggg gcacccagtc atccctggac cgcctgcggg ccctcctgag actgatacag ggcgagcagc tgctccaggt caccatgacg accactagcc ctgccccact gctggccggg ccctggacca agccctcagt ggcagccaca caccccaccg tccagcaccc ccagggccac aactga. It is sometimes possible for the material contained within the vial of "PHF21B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.