Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC45A2 cdna clone

SLC45A2 cDNA Clone

Gene Names
SLC45A2; 1A1; AIM1; MATP; OCA4; SHEP5
Synonyms
SLC45A2; SLC45A2 cDNA Clone; SLC45A2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtagcaacagtgggcaggctggccgccacatctataaatccctagctgatgatggcccctttgactctgtggagccgcctaaaagacccaccagcagactcatcatgcacagcatggccatgttcggaagagagttctgctacgcggtggaggcagcgtatgtgaccccagtcctgctcagcgtaggtctgcccagcagcctgtacagcattgtgtggttcctcagccccatcctgggattcctgctgcagcccgtggtcggatcggccagcgaccactgccggtccaggtggggccgccggagaccctacatcctcaccctgggagtcatgatgctcgtgggcatggctctgtacctcaatggggctactgttgtagcagctttgattgctaacccaaggaggaagctggtttgggccataagtgtcaccatgataggtgtcgttctctttgattttgctgccgacttcattgatgggcccatcaaagcctacttatttgatgtctgctcccatcaggacaaggagaagggcctccactaccatgccctcttcacagactcgcagggcaatgacattaaagtcactgctgagagcactggtgaacatgcctcctcactaccgctacctttgcatcagccacctcattggatggacggccttcctgtccaacatgctgttcttcacagatttcatgggccagattgtgtaccgcggggatccctatag
Sequence Length
732
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,200 Da
NCBI Official Full Name
Homo sapiens solute carrier family 45, member 2, mRNA
NCBI Official Synonym Full Names
solute carrier family 45 member 2
NCBI Official Symbol
SLC45A2
NCBI Official Synonym Symbols
1A1; AIM1; MATP; OCA4; SHEP5
NCBI Protein Information
membrane-associated transporter protein
UniProt Protein Name
Membrane-associated transporter protein
UniProt Gene Name
SLC45A2
UniProt Synonym Gene Names
AIM1; MATP; Protein AIM-1
UniProt Entry Name
S45A2_HUMAN

NCBI Description

This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

Uniprot Description

SLC45A2: Melanocyte differentiation antigen. May transport substances required for melanin biosynthesis. Defects in SLC45A2 are the cause of albinism oculocutaneous type 4 (OCA4). A disorder of pigmentation characterized by reduced biosynthesis of melanin in the skin, hair and eyes. Patients show reduced or lacking pigmentation associated with classic albinism ocular abnormalities, including decreased visual acuity, macular hypoplasia, optic dysplasia, atypical choroidal vessels, and nystagmus. Belongs to the glycoside-pentoside-hexuronide (GPH) cation symporter transporter (TC 2.A.2) family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Transporter, SLC family; Membrane protein, integral; Transporter

Chromosomal Location of Human Ortholog: 5p13.2

Molecular Function: sucrose:hydrogen symporter activity

Biological Process: sucrose transport

Disease: Albinism, Oculocutaneous, Type Iv; Skin/hair/eye Pigmentation, Variation In, 5

Research Articles on SLC45A2

Similar Products

Product Notes

The SLC45A2 slc45a2 (Catalog #AAA1272781) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtagca acagtgggca ggctggccgc cacatctata aatccctagc tgatgatggc ccctttgact ctgtggagcc gcctaaaaga cccaccagca gactcatcat gcacagcatg gccatgttcg gaagagagtt ctgctacgcg gtggaggcag cgtatgtgac cccagtcctg ctcagcgtag gtctgcccag cagcctgtac agcattgtgt ggttcctcag ccccatcctg ggattcctgc tgcagcccgt ggtcggatcg gccagcgacc actgccggtc caggtggggc cgccggagac cctacatcct caccctggga gtcatgatgc tcgtgggcat ggctctgtac ctcaatgggg ctactgttgt agcagctttg attgctaacc caaggaggaa gctggtttgg gccataagtg tcaccatgat aggtgtcgtt ctctttgatt ttgctgccga cttcattgat gggcccatca aagcctactt atttgatgtc tgctcccatc aggacaagga gaagggcctc cactaccatg ccctcttcac agactcgcag ggcaatgaca ttaaagtcac tgctgagagc actggtgaac atgcctcctc actaccgcta cctttgcatc agccacctca ttggatggac ggccttcctg tccaacatgc tgttcttcac agatttcatg ggccagattg tgtaccgcgg ggatccctat ag. It is sometimes possible for the material contained within the vial of "SLC45A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.