Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MRAP2 cdna clone

MRAP2 cDNA Clone

Gene Names
MRAP2; BMIQ18; C6orf117; bA51G5.2
Synonyms
MRAP2; MRAP2 cDNA Clone; MRAP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccgcccagaggttaatttctaacagaacctcccagcaatcggcatctaattctgattacacctgggaatatgaatattatgagattggaccagtttcctttgaaggactgaaggctcataaatattccattgtgattggattttgggttggtcttgcagtcttcgtgatttttatgttttttgtgctgaccttgctgaccaagacaggagccccacaccaagacaatgcagagtcctcagagaagagattcagaatgaacagctttgtgtcagactttggaagacctctggagccagataaagtattttctcgccaaggcaacgaggagtccaggtctctctttcactgctacatcaatgaggtggaacgcttggacagagccaaagcttgtcaccagaccacagcccttgacagtgacgtccaactccaggaagccatcagaagcagtgggcagccagaggaggagctgaacaggctcatgaagtttgacatccccaactttgtgaacacagaccagaactactttggggaggatgatcttctgatttctgaaccacctattgttctggaaactaagccactttcccagacctcacacaaagacctggattga
Sequence Length
618
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,548 Da
NCBI Official Full Name
Homo sapiens melanocortin 2 receptor accessory protein 2, mRNA
NCBI Official Synonym Full Names
melanocortin 2 receptor accessory protein 2
NCBI Official Symbol
MRAP2
NCBI Official Synonym Symbols
BMIQ18; C6orf117; bA51G5.2
NCBI Protein Information
melanocortin-2 receptor accessory protein 2
UniProt Protein Name
Melanocortin-2 receptor accessory protein 2
UniProt Gene Name
MRAP2
UniProt Synonym Gene Names
C6orf117; MC2R accessory protein 2
UniProt Entry Name
MRAP2_HUMAN

Uniprot Description

MRAP2: Modulator of melanocortin receptor 4 (MC4R), a receptor involved in energy homeostasis. Plays a central role in the control of energy homeostasis and body weight regulation by increasing ligand-sensitivity of MC4R and MC4R-mediated generation of cAMP. May also act as a negative regulator of MC2R: competes with MRAP for binding to MC2R and impairs the binding of corticotropin (ACTH) to MC2R. May also regulate activity of other melanocortin receptors (MC1R, MC3R and MC5R); however, additional evidences are required in vivo. Belongs to the MRAP family. Homodimer and heterodimer. Forms antiparallel homodimers and heterodimers with MRAP. Interacts with MC1R, MC2R, MC3R, MC4R and MC5R

Chromosomal Location of Human Ortholog: 6q14.2

Cellular Component: endoplasmic reticulum; plasma membrane

Molecular Function: adrenocorticotropin hormone receptor binding; identical protein binding; protein binding; type 3 melanocortin receptor binding; type 4 melanocortin receptor binding; type 5 melanocortin receptor binding

Biological Process: energy reserve metabolic process; feeding behavior; positive regulation of cAMP biosynthetic process

Disease: Body Mass Index Quantitative Trait Locus 18

Research Articles on MRAP2

Similar Products

Product Notes

The MRAP2 mrap2 (Catalog #AAA1272684) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgccc agaggttaat ttctaacaga acctcccagc aatcggcatc taattctgat tacacctggg aatatgaata ttatgagatt ggaccagttt cctttgaagg actgaaggct cataaatatt ccattgtgat tggattttgg gttggtcttg cagtcttcgt gatttttatg ttttttgtgc tgaccttgct gaccaagaca ggagccccac accaagacaa tgcagagtcc tcagagaaga gattcagaat gaacagcttt gtgtcagact ttggaagacc tctggagcca gataaagtat tttctcgcca aggcaacgag gagtccaggt ctctctttca ctgctacatc aatgaggtgg aacgcttgga cagagccaaa gcttgtcacc agaccacagc ccttgacagt gacgtccaac tccaggaagc catcagaagc agtgggcagc cagaggagga gctgaacagg ctcatgaagt ttgacatccc caactttgtg aacacagacc agaactactt tggggaggat gatcttctga tttctgaacc acctattgtt ctggaaacta agccactttc ccagacctca cacaaagacc tggattga. It is sometimes possible for the material contained within the vial of "MRAP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.