Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB11B cdna clone

RAB11B cDNA Clone

Gene Names
RAB11B; H-YPT3
Synonyms
RAB11B; RAB11B cDNA Clone; RAB11B cdna clone
Ordering
For Research Use Only!
Sequence
ATGGGGACCCGGGACGACGAGTACGACTACCTATTCAAAGTGGTGCTCATCGGGGACTCAGGCGTGGGCAAGAGCAACCTGCTGTCGCGCTTCACCCGCAACGAGTTCAACCTGGAGAGCAAGAGCACCATCGGCGTGGAGTTCGCCACCCGCAGCATCCAGGTGGACGGCAAGACCATCAAGGCGCAGATCTGGGACACCGCTGGCCAGGAGCGCTACCGCGCCATCACCTCCGCGTACTACCGTGGTGCAGTGGGCGCCCTGCTGGTGTACGACATCGCCAAGCACCTGACCTATGAGAACGTGGAGCGCTGGCTGAAGGAGCTGCGGGACCACGCAGACAGCAACATCGTCATCATGCTGGTGGGCAACAAGAGTGACCTGCGCCACCTGCGGGCTGTGCCCACTGACGAGGCCCGCGCCTTCGCAGAAAAGAACAACTTGTCCTTCATCGAGACCTCAGCCTTGGATTCCACTAACGTAGAGGAAGCATTCAAGAACATCCTCACAGAGATCTACCGCATCGTGTCACAGAAACAGATCGCAGACCGTGCTGCCCACGACGAGTCCCCGGGGAACAACGTGGTGGACATCAGCGTGCCGCCCACCACGGACGGACAGAAGCCCAACAAGCTGCAGTGCTGCCAGAACCTGTGA
Sequence Length
657
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,971 Da
NCBI Official Full Name
Homo sapiens RAB11B, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB11B, member RAS oncogene family
NCBI Official Symbol
RAB11B
NCBI Official Synonym Symbols
H-YPT3
NCBI Protein Information
ras-related protein Rab-11B
UniProt Protein Name
Ras-related protein Rab-11B
Protein Family
UniProt Gene Name
RAB11B
UniProt Synonym Gene Names
YPT3
UniProt Entry Name
RB11B_HUMAN

NCBI Description

The Ras superfamily of small GTP-binding proteins, which includes the Ras (see MIM 190020), Ral (see MIM 179550), Rho (see MIM 165390), Rap (see MIM 179520), and Rab (see MIM 179508) families, is involved in controlling a diverse set of essential cellular functions. The Rab family, including RAB11B, appears to play a critical role in regulating exocytotic and endocytotic pathways (summary by Zhu et al., 1994 [PubMed 7811277]).[supplied by OMIM, Nov 2010]

Uniprot Description

RAB11B: GTPase that modulates endosomal trafficking. Acts as a major regulator of membrane delivery during cytokinesis. Interacts with RAB11FIP1, RAB11FIP2, RAB11FIP3 and RAB11FIP4. Belongs to the small GTPase superfamily. Rab family.

Protein type: G protein, monomeric; G protein; G protein, monomeric, Rab

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: cell junction; cell-cell adherens junction; microtubule organizing center; phagocytic vesicle; plasma membrane; recycling endosome; synaptic vesicle

Molecular Function: GDP binding; GTP binding; GTPase activity; myosin V binding; protein binding

Biological Process: constitutive secretory pathway; melanosome transport; receptor recycling; regulated secretory pathway; transferrin transport

Research Articles on RAB11B

Similar Products

Product Notes

The RAB11B rab11b (Catalog #AAA1272641) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGGGACCC GGGACGACGA GTACGACTAC CTATTCAAAG TGGTGCTCAT CGGGGACTCA GGCGTGGGCA AGAGCAACCT GCTGTCGCGC TTCACCCGCA ACGAGTTCAA CCTGGAGAGC AAGAGCACCA TCGGCGTGGA GTTCGCCACC CGCAGCATCC AGGTGGACGG CAAGACCATC AAGGCGCAGA TCTGGGACAC CGCTGGCCAG GAGCGCTACC GCGCCATCAC CTCCGCGTAC TACCGTGGTG CAGTGGGCGC CCTGCTGGTG TACGACATCG CCAAGCACCT GACCTATGAG AACGTGGAGC GCTGGCTGAA GGAGCTGCGG GACCACGCAG ACAGCAACAT CGTCATCATG CTGGTGGGCA ACAAGAGTGA CCTGCGCCAC CTGCGGGCTG TGCCCACTGA CGAGGCCCGC GCCTTCGCAG AAAAGAACAA CTTGTCCTTC ATCGAGACCT CAGCCTTGGA TTCCACTAAC GTAGAGGAAG CATTCAAGAA CATCCTCACA GAGATCTACC GCATCGTGTC ACAGAAACAG ATCGCAGACC GTGCTGCCCA CGACGAGTCC CCGGGGAACA ACGTGGTGGA CATCAGCGTG CCGCCCACCA CGGACGGACA GAAGCCCAAC AAGCTGCAGT GCTGCCAGAA CCTGTGA. It is sometimes possible for the material contained within the vial of "RAB11B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.