Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OPCML cdna clone

OPCML cDNA Clone

Gene Names
OPCML; OPCM; OBCAM; IGLON1
Synonyms
OPCML; OPCML cDNA Clone; OPCML cdna clone
Ordering
For Research Use Only!
Sequence
atgggggtctgtgggtacctgttcctgccctggaagtgcctcgtggtcgtgtctctcaggctgctgttccttgtacccacaggagtgcccgtgcgcagcggagatgccaccttccccaaagctatggacaacgtgacggtccggcagggggagagcgccaccctcaggtgtaccatagatgaccgggtaacccgggtggcctggctaaaccgcagcaccatcctctacgctgggaatgacaagtggtccatagaccctcgtgtgatcatcctggtcaatacaccaacccagtacagcatcatgatccaaaatgtggatgtgtatgacgaaggtccgtacacctgctctgtgcagacagacaatcatcccaaaacgtcccgggttcacctaatagtgcaagttcctcctcagatcatgaatatctcctcagacatcactgtgaatgagggaagcagtgtgaccctgctgtgtcttgctattggcagaccagagccaactgtgacatggagacacctgtcagtcaaggaaggccagggctttgtaagtgaggatgagtacctggagatctctgacatcaagcgagaccagtccggggagtacgaatgcagcgcgttgaacgatgtcgctgcgcccgatgtgcggaaagtaaaaatcactgtaaactatcctccctatatctcaaaagccaagaacactggtgtttcagtcggtcagaagggcatcctgagctgtgaagcctctgcagtccccatggctgaattccagtggttcaaggaagaaaccaggttagccactggtctggatggaatgaggattgaaaacaaaggccgcatgtccactctgactttcttcaatgtttcagaaaaggattatgggaactatacttgtgtggccacgaacaagcttgggaacaccaatgccagcatcacattgtatgggcctggagcagtcattgatggtgtaaactcggcctccagagcactggcttgtctctggctatcagggaccctcttagcccacttcttcatcaagttttga
Sequence Length
1038
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,849 Da
NCBI Official Full Name
Homo sapiens opioid binding protein/cell adhesion molecule-like, mRNA
NCBI Official Synonym Full Names
opioid binding protein/cell adhesion molecule like
NCBI Official Symbol
OPCML
NCBI Official Synonym Symbols
OPCM; OBCAM; IGLON1
NCBI Protein Information
opioid-binding protein/cell adhesion molecule
UniProt Protein Name
Opioid-binding protein/cell adhesion molecule
UniProt Gene Name
OPCML
UniProt Synonym Gene Names
IGLON1; OBCAM; OBCAM; OPCML; Opioid-binding cell adhesion molecule
UniProt Entry Name
OPCM_HUMAN

NCBI Description

This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]

Uniprot Description

OPCML: Binds opioids in the presence of acidic lipids; probably involved in cell contact. Defects in OPCML are a cause of susceptibility to ovarian cancer (OC). Ovarian cancer common malignancy originating from ovarian tissue. Although many histologic types of ovarian neoplasms have been described, epithelial ovarian carcinoma is the most common form. Ovarian cancers are often asymptomatic and the recognized signs and symptoms, even of late- stage disease, are vague. Consequently, most patients are diagnosed with advanced disease. Belongs to the immunoglobulin superfamily. IgLON family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Receptor, misc.; Membrane protein, GPI anchor

Chromosomal Location of Human Ortholog: 11q25

Biological Process: neuron recognition

Disease: Ovarian Cancer

Research Articles on OPCML

Similar Products

Product Notes

The OPCML opcml (Catalog #AAA1272600) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggtct gtgggtacct gttcctgccc tggaagtgcc tcgtggtcgt gtctctcagg ctgctgttcc ttgtacccac aggagtgccc gtgcgcagcg gagatgccac cttccccaaa gctatggaca acgtgacggt ccggcagggg gagagcgcca ccctcaggtg taccatagat gaccgggtaa cccgggtggc ctggctaaac cgcagcacca tcctctacgc tgggaatgac aagtggtcca tagaccctcg tgtgatcatc ctggtcaata caccaaccca gtacagcatc atgatccaaa atgtggatgt gtatgacgaa ggtccgtaca cctgctctgt gcagacagac aatcatccca aaacgtcccg ggttcaccta atagtgcaag ttcctcctca gatcatgaat atctcctcag acatcactgt gaatgaggga agcagtgtga ccctgctgtg tcttgctatt ggcagaccag agccaactgt gacatggaga cacctgtcag tcaaggaagg ccagggcttt gtaagtgagg atgagtacct ggagatctct gacatcaagc gagaccagtc cggggagtac gaatgcagcg cgttgaacga tgtcgctgcg cccgatgtgc ggaaagtaaa aatcactgta aactatcctc cctatatctc aaaagccaag aacactggtg tttcagtcgg tcagaagggc atcctgagct gtgaagcctc tgcagtcccc atggctgaat tccagtggtt caaggaagaa accaggttag ccactggtct ggatggaatg aggattgaaa acaaaggccg catgtccact ctgactttct tcaatgtttc agaaaaggat tatgggaact atacttgtgt ggccacgaac aagcttggga acaccaatgc cagcatcaca ttgtatgggc ctggagcagt cattgatggt gtaaactcgg cctccagagc actggcttgt ctctggctat cagggaccct cttagcccac ttcttcatca agttttga. It is sometimes possible for the material contained within the vial of "OPCML, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.