SLC35F5 cdna clone
SLC35F5 cDNA Clone
Synonyms
SLC35F5; SLC35F5 cDNA Clone; SLC35F5 cdna clone
Sequence
atggtgccgccacgacgccatcgcggggcaggaaggccaggggtgctgagttcttcacctccttttagactgagatctgccaagttttccggcattgctcttgaggatctcagaagggctcttaagacaagactgcaaatggtgtgtgtatttgtcatgaaccgaatgaattcccagaacagtggtttcactcagcgcaggcgaatggctcttgggattgttattcttctgcttgttgatgtgatatgggttgcttcctctgaacttacttcgtatgtttttacccagtacaacaaaccattcttcagcacctttgcaaaaacatctatgtttgttttgtaccttttgggctttattatttggaagccatggagacaacagtgtacaagaggacttcgcggaaagcatgctgctttttttgcagatgctgaaggttactttgctgcttgcacaacagatacaactatgaatagttctttgagtgaacctctgtatgtgcctgtgaaattccatgatcttccaagtgaaaaacctgagagcacaaacattgatactgaaaaaacccccaaaaagtctcgtgtgaggttcagtaatatcatggagattcgacagcttccgtcaagtcatgcattggaagcaaagttgtctcgcatgtcatatcctgtgaaagaacaagaatccatactgaaaactgtggggaaacttactgcaactcaagtagcgaaaattagcttttttttttgctttgtgtggtttttggcaaatttgtcatatcaagaagcactttcagacacacaagttgctatagttaatattttatcttcaacttccggactttttaccttaatccttgctgcagtatttccaagtaacagtggagatagatttaccctttctaaactattagctgtaattttaagcattggaggcgttgtactggtaaacctggcagggtctgaaaaacctgctggaagagacacagtaggttccatttggtctcttgctggagccatgctctatgctgtctatattgttatgattaagagaaaagtagatagagaagacaagttggatattccaatgttctttggttttgtaggtttgtttaatctgctgctcttatggccaggtttctttttacttcattatactggatttgaggacttcgagtttcccaataaagtagtattaatgtgcattatcattaatggccttattggaacagtactctcagagttcctgtggttgtggggctgctttcttacctcatcattgataggcacacttgcactaagccttacaatacctctgtccataatagctgacatgtgtatgcaaaaggtgcagttttcttggttattttttgcaggagctatccctgtatttttttcattttttattgtaactctcctatgccattataataattgggatcctgtgatggtgggaatcagaagaatatttgcttttatatgcagaaaacatcgaattcagagagttccagaagacagcgaacagtgtgagagtctcatttctatgcacagtgtttctcaggaggatggagctagttag
Sequence Length
1572
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,826 Da
NCBI Official Full Name
Homo sapiens solute carrier family 35, member F5, mRNA
NCBI Official Synonym Full Names
solute carrier family 35 member F5
NCBI Official Symbol
SLC35F5
NCBI Protein Information
solute carrier family 35 member F5
UniProt Protein Name
Solute carrier family 35 member F5
Protein Family
UniProt Gene Name
SLC35F5
UniProt Synonym Gene Names
NS5ATP3; HCV NS5A-transactivated protein 3
UniProt Entry Name
S35F5_HUMAN
Uniprot Description
SLC35F5: Putative solute transporter (Potential). Belongs to the SLC35F solute transporter family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 2q14.1
Biological Process: transport
Similar Products
Product Notes
The SLC35F5 slc35f5 (Catalog #AAA1272482) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgccgc cacgacgcca tcgcggggca ggaaggccag gggtgctgag ttcttcacct ccttttagac tgagatctgc caagttttcc ggcattgctc ttgaggatct cagaagggct cttaagacaa gactgcaaat ggtgtgtgta tttgtcatga accgaatgaa ttcccagaac agtggtttca ctcagcgcag gcgaatggct cttgggattg ttattcttct gcttgttgat gtgatatggg ttgcttcctc tgaacttact tcgtatgttt ttacccagta caacaaacca ttcttcagca cctttgcaaa aacatctatg tttgttttgt accttttggg ctttattatt tggaagccat ggagacaaca gtgtacaaga ggacttcgcg gaaagcatgc tgcttttttt gcagatgctg aaggttactt tgctgcttgc acaacagata caactatgaa tagttctttg agtgaacctc tgtatgtgcc tgtgaaattc catgatcttc caagtgaaaa acctgagagc acaaacattg atactgaaaa aacccccaaa aagtctcgtg tgaggttcag taatatcatg gagattcgac agcttccgtc aagtcatgca ttggaagcaa agttgtctcg catgtcatat cctgtgaaag aacaagaatc catactgaaa actgtgggga aacttactgc aactcaagta gcgaaaatta gctttttttt ttgctttgtg tggtttttgg caaatttgtc atatcaagaa gcactttcag acacacaagt tgctatagtt aatattttat cttcaacttc cggacttttt accttaatcc ttgctgcagt atttccaagt aacagtggag atagatttac cctttctaaa ctattagctg taattttaag cattggaggc gttgtactgg taaacctggc agggtctgaa aaacctgctg gaagagacac agtaggttcc atttggtctc ttgctggagc catgctctat gctgtctata ttgttatgat taagagaaaa gtagatagag aagacaagtt ggatattcca atgttctttg gttttgtagg tttgtttaat ctgctgctct tatggccagg tttcttttta cttcattata ctggatttga ggacttcgag tttcccaata aagtagtatt aatgtgcatt atcattaatg gccttattgg aacagtactc tcagagttcc tgtggttgtg gggctgcttt cttacctcat cattgatagg cacacttgca ctaagcctta caatacctct gtccataata gctgacatgt gtatgcaaaa ggtgcagttt tcttggttat tttttgcagg agctatccct gtattttttt cattttttat tgtaactctc ctatgccatt ataataattg ggatcctgtg atggtgggaa tcagaagaat atttgctttt atatgcagaa aacatcgaat tcagagagtt ccagaagaca gcgaacagtg tgagagtctc atttctatgc acagtgtttc tcaggaggat ggagctagtt ag. It is sometimes possible for the material contained within the vial of "SLC35F5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
