IFRD1 cdna clone
IFRD1 cDNA Clone
Gene Names
IFRD1; PC4; TIS7
Synonyms
IFRD1; IFRD1 cDNA Clone; IFRD1 cdna clone
Sequence
atgccgaagaacaagaagcggaacactccccaccgcggtagcagtgctggcggcggcgggtcaggagcagccgcagcgacggcggcgacagcaggtggccagcatcgaaatgttcagccttttagtgatgaagatgcatcaattgaaacaatgagccattgcagtggttatagcgatccttccagttttgctgaagatggaccagaagtccttgatgaggaaggaactcaagaagacctagagtacaagttgaagggattaattgacctaaccctggataagagtgcgaagacaaggcaagcagctcttgaaggtattaaaaatgcactggcttcaaaaatgctgtatgaatttattctggaaaggagaatgactttaactgatagcattgaacgctgcctgaaaaaaggtaagagtgatgagcaacgtgcagctgcagcgttagcatctgttctttgtattcagctgggccctggaattgaaagtgaagagattttgaaaactcttggaccaatcctaaagaaaatcatttgtgatgggtcagctagtatgcaggctaggcaaacttgtgcaacttgctttggtgtttgctgttttattgccacagatgacattactgaactatactcaactctggaatgtttggaaaatatcttcactaaatcctatctcaaagagaaagacactactgttatttgcagcactcctaatacagtgcttcatatcagctctcttcttgcatggacactactgctgaccatatgcccaatcaatgaagtgaagaaaaagcttgagatgcatttccataagcttccaagcctcctctcttgtgatgatgtaaacatgagaatagctgctggtgaatctttggcacttctctttgaattggccagaggaatagagagtgactttttttatgaagacatggagtccttgacgcagatgcttagggccttggcaacagatggaaataaacaccgggccaaagtggacaagagaaagcagcggtcagttttcagagatgtcctgagggcagtggaggaacgggattttccaacagaaaccattaaatttggtcctgaacgcatgtatattgattgctgggtaaaaaaacacacctatgacacctttaaggaggttcttggatcagggatgcagtaccacttgcagtcaaatgaattccttcgaaatgtatttgaacttggacccccagtgatgcttgatgctgcaacgcttaaaacgatgaagatttctcgtttcgaaaggcatttatataactctgcagccttcaaagctcgaaccaaagctagaagcaaatgtcgagataagagagcagatgttggagaattcttctag
Sequence Length
1356
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,336 Da
NCBI Official Full Name
Homo sapiens interferon-related developmental regulator 1, mRNA
NCBI Official Synonym Full Names
interferon related developmental regulator 1
NCBI Official Symbol
IFRD1
NCBI Official Synonym Symbols
PC4; TIS7
NCBI Protein Information
interferon-related developmental regulator 1
UniProt Protein Name
Interferon-related developmental regulator 1
Protein Family
UniProt Gene Name
IFRD1
UniProt Entry Name
IFRD1_HUMAN
NCBI Description
This gene is an immediate early gene that encodes a protein related to interferon-gamma. This protein may function as a transcriptional co-activator/repressor that controls the growth and differentiation of specific cell types during embryonic development and tissue regeneration. Mutations in this gene are associated with sensory/motor neuropathy with ataxia. This gene may also be involved in modulating the pathogenesis of cystic fibrosis lung disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Uniprot Description
IFRD1: Could play a role in regulating gene activity in the proliferative and/or differentiative pathways induced by NGF. May be an autocrine factor that attenuates or amplifies the initial ligand-induced signal. Belongs to the IFRD family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 7q31.1
Biological Process: myoblast cell fate determination
Research Articles on IFRD1
Similar Products
Product Notes
The IFRD1 ifrd1 (Catalog #AAA1272439) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgaaga acaagaagcg gaacactccc caccgcggta gcagtgctgg cggcggcggg tcaggagcag ccgcagcgac ggcggcgaca gcaggtggcc agcatcgaaa tgttcagcct tttagtgatg aagatgcatc aattgaaaca atgagccatt gcagtggtta tagcgatcct tccagttttg ctgaagatgg accagaagtc cttgatgagg aaggaactca agaagaccta gagtacaagt tgaagggatt aattgaccta accctggata agagtgcgaa gacaaggcaa gcagctcttg aaggtattaa aaatgcactg gcttcaaaaa tgctgtatga atttattctg gaaaggagaa tgactttaac tgatagcatt gaacgctgcc tgaaaaaagg taagagtgat gagcaacgtg cagctgcagc gttagcatct gttctttgta ttcagctggg ccctggaatt gaaagtgaag agattttgaa aactcttgga ccaatcctaa agaaaatcat ttgtgatggg tcagctagta tgcaggctag gcaaacttgt gcaacttgct ttggtgtttg ctgttttatt gccacagatg acattactga actatactca actctggaat gtttggaaaa tatcttcact aaatcctatc tcaaagagaa agacactact gttatttgca gcactcctaa tacagtgctt catatcagct ctcttcttgc atggacacta ctgctgacca tatgcccaat caatgaagtg aagaaaaagc ttgagatgca tttccataag cttccaagcc tcctctcttg tgatgatgta aacatgagaa tagctgctgg tgaatctttg gcacttctct ttgaattggc cagaggaata gagagtgact ttttttatga agacatggag tccttgacgc agatgcttag ggccttggca acagatggaa ataaacaccg ggccaaagtg gacaagagaa agcagcggtc agttttcaga gatgtcctga gggcagtgga ggaacgggat tttccaacag aaaccattaa atttggtcct gaacgcatgt atattgattg ctgggtaaaa aaacacacct atgacacctt taaggaggtt cttggatcag ggatgcagta ccacttgcag tcaaatgaat tccttcgaaa tgtatttgaa cttggacccc cagtgatgct tgatgctgca acgcttaaaa cgatgaagat ttctcgtttc gaaaggcatt tatataactc tgcagccttc aaagctcgaa ccaaagctag aagcaaatgt cgagataaga gagcagatgt tggagaattc ttctag. It is sometimes possible for the material contained within the vial of "IFRD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
