Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

INVS cdna clone

INVS cDNA Clone

Gene Names
INVS; INV; NPH2; NPHP2
Synonyms
INVS; INVS cDNA Clone; INVS cdna clone
Ordering
For Research Use Only!
Sequence
atgaacaagtcagagaacctgctgtttgctggttcatcattagcatcacaagtccatgctgctgccgttaatggagataagggtgctctacagaggctcatcgtaggaaactctgctcttaaagacaaagaagatcagtttgggagaacaccacttatgtattgcgtgttggctgacagattggattgtgcagatgctcttctgaaggcaggagcagatgtgaataaaactgaccatagccagagaacagccctccatcttgcagcccagaaggcattgagaacaatcagcacaggcaggatctaa
Sequence Length
306
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,748 Da
NCBI Official Full Name
Homo sapiens inversin, mRNA
NCBI Official Synonym Full Names
inversin
NCBI Official Symbol
INVS
NCBI Official Synonym Symbols
INV; NPH2; NPHP2
NCBI Protein Information
inversin
UniProt Protein Name
Inversin
Protein Family
UniProt Gene Name
INVS
UniProt Synonym Gene Names
INV; NPHP2
UniProt Entry Name
INVS_HUMAN

NCBI Description

This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]

Uniprot Description

INVS: Required for normal renal development and establishment of left-right axis. Probably acts as a molecular switch between different Wnt signaling pathways. Inhibits the canonical Wnt pathway by targeting cytoplasmic disheveled (DVL1) for degradation by the ubiquitin-proteasome. This suggests that it is required in renal development to oppose the repression of terminal differentiation of tubular epithelial cells by Wnt signaling. Involved in the organization of apical junctions in kidney cells together with NPHP1, NPHP4 and RPGRIP1L/NPHP8. Does not seem to be strictly required for ciliogenesis. Defects in INVS are the cause of nephronophthisis type 2 (NPHP2); also known as infantile nephronophthisis. NPHP2 is an autosomal recessive disorder resulting in end-stage renal disease. It is characterized by early onset and rapid progression. Phenotypic manifestations include enlarged kidneys, chronic tubulo-interstitial nephritis, anemia, hyperkalemic metabolic acidosis. Some patients also display situs inversus. Pathologically, it differs from later-onset nephronophthisis by the absence of medullary cysts and thickened tubular basement membranes and by the presence of cortical microcysts. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 9q31

Molecular Function: protein binding

Disease: Nephronophthisis 2

Research Articles on INVS

Similar Products

Product Notes

The INVS invs (Catalog #AAA1272432) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacaagt cagagaacct gctgtttgct ggttcatcat tagcatcaca agtccatgct gctgccgtta atggagataa gggtgctcta cagaggctca tcgtaggaaa ctctgctctt aaagacaaag aagatcagtt tgggagaaca ccacttatgt attgcgtgtt ggctgacaga ttggattgtg cagatgctct tctgaaggca ggagcagatg tgaataaaac tgaccatagc cagagaacag ccctccatct tgcagcccag aaggcattga gaacaatcag cacaggcagg atctaa. It is sometimes possible for the material contained within the vial of "INVS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.