Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DCLRE1C cdna clone

DCLRE1C cDNA Clone

Gene Names
DCLRE1C; SCIDA; SNM1C; A-SCID; RS-SCID; DCLREC1C
Synonyms
DCLRE1C; DCLRE1C cDNA Clone; DCLRE1C cdna clone
Ordering
For Research Use Only!
Sequence
atgagttctttcgaggggcagatggccgagtatccaactatctccatagaccgcttcgatagggagaacctgagggcccgcgcctacttcctgtcccactgccacaaagatcacatgaaaggattaagagcccctaccttgaaaagaaggttggagtgcagcttgaaggtttatctatactgttcacctgtgactaaggagttgttgttaacgagcccgaaatacagattttggaagaaacgaattatatctattgaaatcgagactcctacccagatatctttagtggatgaagcatcaggagagaaggaagagattgttgtgactctcttaccagctggtcactgtccgggatcagttatgtttttatttcagggcaataatggaactgtcctgtacacaggagacttcagattggcgcaaggagaagctgctagaatggagcttctgcactccgggggcagagtcaaagacatccaaagtgtatatttggatactacgttctgtgatccaagattttaccaaattccaagtcgggaggagtgtttaagtggagtcttagagctggtccgaagctggatcactcggagcccgtaccatgttgtgtggctgaactgcaaagcggcttatggctatgaatatttgttcaccaaccttagtgaagaattaggagtccaggttcatgtgaataagctagacatgtttaggaacatgcctgagatccttcgtcatctcacaacagaccgcaacactcagatccatgcatgccggcatcccaaggcagaggaatattttcagtggagcaaattaccctgtggaattacttccagaaatagaattccactccacataatcagcattaagccatccaccatgtggtttggagaaaggagcagaaaaacaaatgtaattgtgaggactggagagagttcatacagagcttgtttttcttttcactcctcctacagtgagattaaagatttcttgagctacctctgtcctgtgaacgcatatccaaatgtcattccagttggcacaactatggataaagttgtcgaaatcttaaagcctttatgccggtcttcccaaagtacggagccaaagtataaaccactgggaaaactgaagagagctagaacagttcaccgagactcagggtctcactctgtcactcaggctagaatgcggtggtgccatcatgactccctgtatcctttaactcctgggatcaagcgatcttcctgcctcagcctcctgactagctggatcacaggtgcataccgccatgcccagctaatgatttag
Sequence Length
1305
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,944 Da
NCBI Official Full Name
Homo sapiens DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae), mRNA
NCBI Official Synonym Full Names
DNA cross-link repair 1C
NCBI Official Symbol
DCLRE1C
NCBI Official Synonym Symbols
SCIDA; SNM1C; A-SCID; RS-SCID; DCLREC1C
NCBI Protein Information
protein artemis
UniProt Protein Name
Protein artemis
Protein Family
UniProt Gene Name
DCLRE1C
UniProt Synonym Gene Names
ARTEMIS; ASCID; SCIDA; SNM1C; hSNM1C
UniProt Entry Name
DCR1C_HUMAN

NCBI Description

This gene encodes a nuclear protein that is involved in V(D)J recombination and DNA repair. The encoded protein has single-strand-specific 5'-3' exonuclease activity; it also exhibits endonuclease activity on 5' and 3' overhangs and hairpins. The protein also functions in the regulation of the cell cycle in response to DNA damage. Mutations in this gene can cause Athabascan-type severe combined immunodeficiency (SCIDA) and Omenn syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Uniprot Description

Artemis: Required for V(D)J recombination, the process by which exons encoding the antigen-binding domains of immunoglobulins and T-cell receptor proteins are assembled from individual V, (D), and J gene segments. V(D)J recombination is initiated by the lymphoid specific RAG endonuclease complex, which generates site specific DNA double strand breaks (DSBs). These DSBs present two types of DNA end structures: hairpin sealed coding ends and phosphorylated blunt signal ends. These ends are independently repaired by the non homologous end joining (NHEJ) pathway to form coding and signal joints respectively. This protein exhibits single-strand specific 5'-3' exonuclease activity in isolation and acquires endonucleolytic activity on 5' and 3' hairpins and overhangs when in a complex with PRKDC. The latter activity is required specifically for the resolution of closed hairpins prior to the formation of the coding joint. May also be required for the repair of complex DSBs induced by ionizing radiation, which require substantial end-processing prior to religation by NHEJ. Defects in DCLRE1C are a cause of severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell- negative/NK-cell-positive with sensitivity to ionizing radiation (RSSCID). SCID refers to a genetically and clinically heterogeneous group of rare congenital disorders characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. Patients with SCID present in infancy with recurrent, persistent infections by opportunistic organisms. The common characteristic of all types of SCID is absence of T-cell-mediated cellular immunity due to a defect in T- cell development. Individuals affected by RS-SCID show defects in the DNA repair machinery necessary for coding joint formation and the completion of V(D)J recombination. A subset of cells from such patients show increased radiosensitivity. Defects in DCLRE1C are the cause of severe combined immunodeficiency Athabaskan type (SCIDA). SCIDA is a variety of RS-SCID caused by a founder mutation in Athabascan- speaking native Americans, being inherited as an autosomal recessive trait with an estimated gene frequency of 2.1% in the Navajo population. Affected individuals exhibit clinical symptoms and defects in DNA repair comparable to those seen in RS-SCID. Defects in DCLRE1C are a cause of Omenn syndrome (OS). OS is characterized by severe combined immunodeficiency associated with erythrodermia, hepatosplenomegaly, lymphadenopathy and alopecia. Affected individuals have elevated T-lymphocyte counts with a restricted T- cell receptor (TCR) repertoire. They also generally lack B- lymphocytes, but have normal natural killer (NK) cell function (T+ B- NK+). Belongs to the DNA repair metallo-beta-lactamase (DRMBL) family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Deoxyribonuclease; DNA repair, damage; EC 3.1.-.-

Chromosomal Location of Human Ortholog: 10p13

Cellular Component: nuclear chromosome, telomeric region; nucleoplasm

Molecular Function: 5'-3' exodeoxyribonuclease activity; 5'-3' exonuclease activity; damaged DNA binding; endonuclease activity; protein binding; single-stranded DNA specific endodeoxyribonuclease activity

Biological Process: double-strand break repair via nonhomologous end joining; protection from non-homologous end joining at telomere

Disease: Omenn Syndrome; Severe Combined Immunodeficiency With Sensitivity To Ionizing Radiation

Research Articles on DCLRE1C

Similar Products

Product Notes

The DCLRE1C dclre1c (Catalog #AAA1272358) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagttctt tcgaggggca gatggccgag tatccaacta tctccataga ccgcttcgat agggagaacc tgagggcccg cgcctacttc ctgtcccact gccacaaaga tcacatgaaa ggattaagag cccctacctt gaaaagaagg ttggagtgca gcttgaaggt ttatctatac tgttcacctg tgactaagga gttgttgtta acgagcccga aatacagatt ttggaagaaa cgaattatat ctattgaaat cgagactcct acccagatat ctttagtgga tgaagcatca ggagagaagg aagagattgt tgtgactctc ttaccagctg gtcactgtcc gggatcagtt atgtttttat ttcagggcaa taatggaact gtcctgtaca caggagactt cagattggcg caaggagaag ctgctagaat ggagcttctg cactccgggg gcagagtcaa agacatccaa agtgtatatt tggatactac gttctgtgat ccaagatttt accaaattcc aagtcgggag gagtgtttaa gtggagtctt agagctggtc cgaagctgga tcactcggag cccgtaccat gttgtgtggc tgaactgcaa agcggcttat ggctatgaat atttgttcac caaccttagt gaagaattag gagtccaggt tcatgtgaat aagctagaca tgtttaggaa catgcctgag atccttcgtc atctcacaac agaccgcaac actcagatcc atgcatgccg gcatcccaag gcagaggaat attttcagtg gagcaaatta ccctgtggaa ttacttccag aaatagaatt ccactccaca taatcagcat taagccatcc accatgtggt ttggagaaag gagcagaaaa acaaatgtaa ttgtgaggac tggagagagt tcatacagag cttgtttttc ttttcactcc tcctacagtg agattaaaga tttcttgagc tacctctgtc ctgtgaacgc atatccaaat gtcattccag ttggcacaac tatggataaa gttgtcgaaa tcttaaagcc tttatgccgg tcttcccaaa gtacggagcc aaagtataaa ccactgggaa aactgaagag agctagaaca gttcaccgag actcagggtc tcactctgtc actcaggcta gaatgcggtg gtgccatcat gactccctgt atcctttaac tcctgggatc aagcgatctt cctgcctcag cctcctgact agctggatca caggtgcata ccgccatgcc cagctaatga tttag. It is sometimes possible for the material contained within the vial of "DCLRE1C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.