Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KIN cdna clone

KIN cDNA Clone

Gene Names
KIN; BTCD; Rts2; KIN17
Synonyms
KIN; KIN cDNA Clone; KIN cdna clone
Ordering
For Research Use Only!
Sequence
atggggaagtcggattttcttactcccaaggctatcgccaacaggatcaagtccaaggggctgcagaagctacgctggtattgccagatgtgccagaagcagtgccgggacgagaatggctttaagtgtcattgtatgtccgaatctcatcagagacaactattgctggcttcagaaaatcctcagcagtttatggattatttttcagaggaattccgaaatgactttctagaacttctcaggagacgctttggcactaaaagggtccacaacaacattgtctacaacgaatacatcagccaccgagagcacatccacatgaatgccactcagtgggaaactctgactgattttactaagtggctgggcagagaaggcttgtgcaaagtggacgagacaccaaaaggctggtatattcagtacatagacagggacccagaaactatccgccggcaactggaactggagaaaaagaaaaagcaggaccttgatgatgaagaaaaaactgccaaatttattgaagagcaagtgagaagaggcctggaagggaaggaacaggaggtccctacttttacggaattaagcagagaaaatgatgaagagaaagtcacgtttaatttgagtaaaggagcatgtagctcatccggagcaacatcttccaagtcaagtactctgggaccgagtgcactgaagacgataggaagttcagcatcagtgaaacgaaaagaatcttcccagagctcaactcagtctaaagaaaagaagaaaaagaaatctgcactggatgaaatcatggagattgaagaggaaaagaaaagaactgcccgaacagactactggctacagcctgaaattattgtgaaaattataaccaagaaactgggagagaaatatcataagaaaaaggctattgttaaggaagtaattgacaaatatacagctgttgtgaagatgattgattctggagacaagctgaaacttgaccagactcatttagagacagtaattccagcaccaggaaaaagaattctagttttaaatggaggctacagaggaaatgaaggtaccctagaatccatcaatgagaagactttttcagctactatcgtcattgaaactggccctttaaaaggacgcagagttgaaggaattcaatatgaagacatttctaaacttgcctga
Sequence Length
1182
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,261 Da
NCBI Official Full Name
Homo sapiens KIN, antigenic determinant of recA protein homolog (mouse), mRNA
NCBI Official Synonym Full Names
Kin17 DNA and RNA binding protein
NCBI Official Symbol
KIN
NCBI Official Synonym Symbols
BTCD; Rts2; KIN17
NCBI Protein Information
DNA/RNA-binding protein KIN17
UniProt Protein Name
DNA/RNA-binding protein KIN17
Protein Family
UniProt Gene Name
KIN
UniProt Entry Name
KIN17_HUMAN

NCBI Description

The protein encoded by this gene is a nuclear protein that forms intranuclear foci during proliferation and is redistributed in the nucleoplasm during the cell cycle. Short-wave ultraviolet light provokes the relocalization of the protein, suggesting its participation in the cellular response to DNA damage. Originally selected based on protein-binding with RecA antibodies, the mouse protein presents a limited similarity with a functional domain of the bacterial RecA protein, a characteristic shared by this human ortholog. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]

Uniprot Description

KIN: Involved in DNA replication and the cellular response to DNA damage. May participate in DNA replication factories and create a bridge between DNA replication and repair mediated by high molecular weight complexes. May play a role in illegitimate recombination and regulation of gene expression. May participate in mRNA processing. Binds, in vitro, to double-stranded DNA. Also shown to bind preferentially to curved DNA in vitro and in vivo. Binds via its C-terminal domain to RNA in vitro. Belongs to the KIN17 family.

Protein type: DNA replication; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 10p14

Cellular Component: intracellular membrane-bound organelle; nuclear matrix; nucleus

Molecular Function: DNA binding; double-stranded DNA binding; RNA binding

Biological Process: DNA replication; mRNA processing; response to DNA damage stimulus

Research Articles on KIN

Similar Products

Product Notes

The KIN kin (Catalog #AAA1272337) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaagt cggattttct tactcccaag gctatcgcca acaggatcaa gtccaagggg ctgcagaagc tacgctggta ttgccagatg tgccagaagc agtgccggga cgagaatggc tttaagtgtc attgtatgtc cgaatctcat cagagacaac tattgctggc ttcagaaaat cctcagcagt ttatggatta tttttcagag gaattccgaa atgactttct agaacttctc aggagacgct ttggcactaa aagggtccac aacaacattg tctacaacga atacatcagc caccgagagc acatccacat gaatgccact cagtgggaaa ctctgactga ttttactaag tggctgggca gagaaggctt gtgcaaagtg gacgagacac caaaaggctg gtatattcag tacatagaca gggacccaga aactatccgc cggcaactgg aactggagaa aaagaaaaag caggaccttg atgatgaaga aaaaactgcc aaatttattg aagagcaagt gagaagaggc ctggaaggga aggaacagga ggtccctact tttacggaat taagcagaga aaatgatgaa gagaaagtca cgtttaattt gagtaaagga gcatgtagct catccggagc aacatcttcc aagtcaagta ctctgggacc gagtgcactg aagacgatag gaagttcagc atcagtgaaa cgaaaagaat cttcccagag ctcaactcag tctaaagaaa agaagaaaaa gaaatctgca ctggatgaaa tcatggagat tgaagaggaa aagaaaagaa ctgcccgaac agactactgg ctacagcctg aaattattgt gaaaattata accaagaaac tgggagagaa atatcataag aaaaaggcta ttgttaagga agtaattgac aaatatacag ctgttgtgaa gatgattgat tctggagaca agctgaaact tgaccagact catttagaga cagtaattcc agcaccagga aaaagaattc tagttttaaa tggaggctac agaggaaatg aaggtaccct agaatccatc aatgagaaga ctttttcagc tactatcgtc attgaaactg gccctttaaa aggacgcaga gttgaaggaa ttcaatatga agacatttct aaacttgcct ga. It is sometimes possible for the material contained within the vial of "KIN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.