Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GDI1 cdna clone

GDI1 cDNA Clone

Gene Names
GDI1; 1A; GDIL; MRX41; MRX48; OPHN2; XAP-4; RABGD1A; RABGDIA
Synonyms
GDI1; GDI1 cDNA Clone; GDI1 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgaggaatacgatgtgatcgtgctggggaccggtctcaccgaatgcatcctgtcgggcatcatgtctgtgaacgggaagaaggtgctgcacatggaccggaacccctactacgggggcgagagctcctccatcacacccctggaggagctgtataagcgttttcagttgctggaggggccccctgagtcgatgggccgaggccgagactggaatgttgacctgattcccaaattcctcatggctaacgggcagctggtaaagatgctactgtatacagaggtgactcgctacctggacttcaaggtggtggagggcagctttgtctacaaggggggcaagatctacaaagtgccgtccactgagactgaggccttggcttccaatctgatgggcatgtttgagaaacggcgcttccgcaagttcctggtgtttgtggcaaacttcgatgagaatgaccccaagacctttgagggcgttgacccccagactaccagcatgcgtgacgtctaccggaagtttgatctgggccaggatgtcatcgatttcactggccatgccctggcgctctaccgcactgatgactacctggaccagccctgccttgagaccgtcaaccgcatcaagttgtacagtgagtccctggcccggtatggcaagagcccatatttatacccgctctacggcttgggcgagctgccccagggttttgcaagattgagtgccatctatggggggacatatatgctgaacaaacctgtggatgacatcatcatggagaacggcaaggtggtgggcgtgaagtctgagggagaggtggcccgctgcaagcagctgatctgtgaccccagctacatcccggaccgtgtgcggaaggctggccaggttatccgcatcatctgtatccttagccaccccatcaagaacaccaacgacgccaactcctgccaaataatcatcccccagaaccaggtcaacaggaagtcagacatctacgtgtgcatgatctcctatgcacacaacgtggcggcccagggcaagtacatagctattgccagcactactgtggagaccacggaccctgaaaaggaggtggagccggctctggagctgttggagcccattgaccagaagtttgtggctatcagtgacttgtatgagcccattgatgatggttgtgagagccaggtgttctgttcctgctcctacgatgccaccacacactttgagacaacctgcaacgacatcaaagacatctacaaacgcatggctggcacggcctttgactttgagaacatgaagcgcaaacagaacgacgtctttggagaagctgagcagtga
Sequence Length
1344
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,583 Da
NCBI Official Full Name
Homo sapiens GDP dissociation inhibitor 1, mRNA
NCBI Official Synonym Full Names
GDP dissociation inhibitor 1
NCBI Official Symbol
GDI1
NCBI Official Synonym Symbols
1A; GDIL; MRX41; MRX48; OPHN2; XAP-4; RABGD1A; RABGDIA
NCBI Protein Information
rab GDP dissociation inhibitor alpha
UniProt Protein Name
Rab GDP dissociation inhibitor alpha
UniProt Gene Name
GDI1
UniProt Synonym Gene Names
GDIL; OPHN2; RABGDIA; XAP4; Rab GDI alpha; GDI-1
UniProt Entry Name
GDIA_HUMAN

NCBI Description

GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI1 is expressed primarily in neural and sensory tissues. Mutations in GDI1 have been linked to X-linked nonspecific mental retardation. [provided by RefSeq, Jul 2008]

Uniprot Description

GDI1: a GDP dissociation inhibitor protein expressed primarily in neural and sensory tissues. GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the Rab family, small GTP-binding proteins of the Ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from Rab proteins and release GDP from membrane-bound Rabs. Mutations have been linked to X-linked nonspecific mental retardation.

Protein type: G protein regulator, misc.; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: cytoplasm; cytosol; midbody

Molecular Function: GDP-dissociation inhibitor activity; protein binding; Rab GDP-dissociation inhibitor activity

Biological Process: negative regulation of axonogenesis; Rab protein signal transduction; regulation of small GTPase mediated signal transduction; signal transduction

Disease: Mental Retardation, X-linked 41

Research Articles on GDI1

Similar Products

Product Notes

The GDI1 gdi1 (Catalog #AAA1272303) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgagg aatacgatgt gatcgtgctg gggaccggtc tcaccgaatg catcctgtcg ggcatcatgt ctgtgaacgg gaagaaggtg ctgcacatgg accggaaccc ctactacggg ggcgagagct cctccatcac acccctggag gagctgtata agcgttttca gttgctggag gggccccctg agtcgatggg ccgaggccga gactggaatg ttgacctgat tcccaaattc ctcatggcta acgggcagct ggtaaagatg ctactgtata cagaggtgac tcgctacctg gacttcaagg tggtggaggg cagctttgtc tacaaggggg gcaagatcta caaagtgccg tccactgaga ctgaggcctt ggcttccaat ctgatgggca tgtttgagaa acggcgcttc cgcaagttcc tggtgtttgt ggcaaacttc gatgagaatg accccaagac ctttgagggc gttgaccccc agactaccag catgcgtgac gtctaccgga agtttgatct gggccaggat gtcatcgatt tcactggcca tgccctggcg ctctaccgca ctgatgacta cctggaccag ccctgccttg agaccgtcaa ccgcatcaag ttgtacagtg agtccctggc ccggtatggc aagagcccat atttataccc gctctacggc ttgggcgagc tgccccaggg ttttgcaaga ttgagtgcca tctatggggg gacatatatg ctgaacaaac ctgtggatga catcatcatg gagaacggca aggtggtggg cgtgaagtct gagggagagg tggcccgctg caagcagctg atctgtgacc ccagctacat cccggaccgt gtgcggaagg ctggccaggt tatccgcatc atctgtatcc ttagccaccc catcaagaac accaacgacg ccaactcctg ccaaataatc atcccccaga accaggtcaa caggaagtca gacatctacg tgtgcatgat ctcctatgca cacaacgtgg cggcccaggg caagtacata gctattgcca gcactactgt ggagaccacg gaccctgaaa aggaggtgga gccggctctg gagctgttgg agcccattga ccagaagttt gtggctatca gtgacttgta tgagcccatt gatgatggtt gtgagagcca ggtgttctgt tcctgctcct acgatgccac cacacacttt gagacaacct gcaacgacat caaagacatc tacaaacgca tggctggcac ggcctttgac tttgagaaca tgaagcgcaa acagaacgac gtctttggag aagctgagca gtga. It is sometimes possible for the material contained within the vial of "GDI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.