Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NTRK2 cdna clone

NTRK2 cDNA Clone

Gene Names
NTRK2; TRKB; trk-B; GP145-TrkB
Synonyms
NTRK2; NTRK2 cDNA Clone; NTRK2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgtcctggataaggtggcatggacccgccatggcgcggctctggggcttctgctggctggttgtgggcttctggagggccgctttcgcctgtcccacgtcctgcaaatgcagtgcctctcggatctggtgcagcgacccttctcctggcatcgtggcatttccgagattggagcctaacagtgtagatcctgagaacatcaccgaaattttcatcgcaaaccagaaaaggttagaaatcatcaacgaagatgatgttgaagcttatgtgggactgagaaatctgacaattgtggattctggattaaaatttgtggctcataaagcatttctgaaaaacagcaacctgcagcacatcaattttacccgaaacaaactgacgagtttgtctaggaaacatttccgtcaccttgacttgtctgaactgatcctggtgggcaatccatttacatgctcctgtgacattatgtggatcaagactctccaagaggctaaatccagtccagacactcaggatttgtactgcctgaatgaaagcagcaagaatattcccctggcaaacctgcagatacccaattgtggtttgccatctgcaaatctggccgcacctaacctcactgtggaggaaggaaagtctatcacattatcctgtagtgtggcaggtgatccggttcctaatatgtattgggatgttggtaacctggtttccaaacatatgaatgaaacaagccacacacagggctccttaaggataactaacatttcatccgatgacagtgggaagcagatctcttgtgtggcggaaaatcttgtaggagaagatcaagattctgtcaacctcactgtgcattttgcaccaactatcacatttctcgaatctccaacctcagaccaccactggtgcattccattcactgtgaaaggcaaccccaaaccagcgcttcagtggttctataacggggcaatattgaatgagtccaaatacatctgtactaaaatacatgttaccaatcacacggagtaccacggctgcctccagctggataatcccactcacatgaacaatggggactacactctaatagccaagaatgagtatgggaaggatgagaaacagatttctgctcacttcatgggctggcctggaattgacgatggtgcaaacccaaattatcctgatgtaatttatgaagattatggaactgcagcgaatgacatcggggacaccacgaacagaagtaatgaaatcccttccacagacgtcactgataaaaccggtcgggaacatctctcggtctatgctgtggtggtgattgcgtctgtggtgggattttgccttttggtaatgctgtttctgcttaagttggcaagacactccaagtttggcatgaaaggttttgttttgtttcataagatcccactggatgggtag
Sequence Length
1434
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,332 Da
NCBI Official Full Name
Homo sapiens neurotrophic tyrosine kinase, receptor, type 2, mRNA
NCBI Official Synonym Full Names
neurotrophic receptor tyrosine kinase 2
NCBI Official Symbol
NTRK2
NCBI Official Synonym Symbols
TRKB; trk-B; GP145-TrkB
NCBI Protein Information
BDNF/NT-3 growth factors receptor
UniProt Protein Name
BDNF/NT-3 growth factors receptor
UniProt Gene Name
NTRK2
UniProt Synonym Gene Names
TRKB; Trk-B
UniProt Entry Name
NTRK2_HUMAN

NCBI Description

This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]

Uniprot Description

TrkB: a receptor tyrosine kinase of the Trk family. Receptor for brain-derived neurotrophic factor (BDNF), neurotrophin-3, -4 and -5 but not nerve growth factor (NGF). Involved in the development and maintenance of the nervous system. Three splice variant isoforms have been described.

Protein type: Protein kinase, TK; Membrane protein, integral; EC 2.7.10.1; Kinase, protein; Protein kinase, tyrosine (receptor); TK group; Trk family

Chromosomal Location of Human Ortholog: 9q22.1

Cellular Component: integral to plasma membrane; receptor complex

Molecular Function: brain-derived neurotrophic factor binding; brain-derived neurotrophic factor receptor activity; neurotrophin binding; protein homodimerization activity

Biological Process: brain-derived neurotrophic factor receptor signaling pathway; central nervous system neuron development; cerebral cortex development; learning; negative regulation of neuron apoptosis; neuron differentiation; neuron migration; positive regulation of axonogenesis; positive regulation of cell proliferation; positive regulation of MAPKKK cascade; positive regulation of phosphoinositide 3-kinase cascade; positive regulation of protein amino acid phosphorylation; protein amino acid autophosphorylation; regulation of GTPase activity

Disease: Obesity, Hyperphagia, And Developmental Delay

Research Articles on NTRK2

Similar Products

Product Notes

The NTRK2 ntrk2 (Catalog #AAA1272250) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgtcct ggataaggtg gcatggaccc gccatggcgc ggctctgggg cttctgctgg ctggttgtgg gcttctggag ggccgctttc gcctgtccca cgtcctgcaa atgcagtgcc tctcggatct ggtgcagcga cccttctcct ggcatcgtgg catttccgag attggagcct aacagtgtag atcctgagaa catcaccgaa attttcatcg caaaccagaa aaggttagaa atcatcaacg aagatgatgt tgaagcttat gtgggactga gaaatctgac aattgtggat tctggattaa aatttgtggc tcataaagca tttctgaaaa acagcaacct gcagcacatc aattttaccc gaaacaaact gacgagtttg tctaggaaac atttccgtca ccttgacttg tctgaactga tcctggtggg caatccattt acatgctcct gtgacattat gtggatcaag actctccaag aggctaaatc cagtccagac actcaggatt tgtactgcct gaatgaaagc agcaagaata ttcccctggc aaacctgcag atacccaatt gtggtttgcc atctgcaaat ctggccgcac ctaacctcac tgtggaggaa ggaaagtcta tcacattatc ctgtagtgtg gcaggtgatc cggttcctaa tatgtattgg gatgttggta acctggtttc caaacatatg aatgaaacaa gccacacaca gggctcctta aggataacta acatttcatc cgatgacagt gggaagcaga tctcttgtgt ggcggaaaat cttgtaggag aagatcaaga ttctgtcaac ctcactgtgc attttgcacc aactatcaca tttctcgaat ctccaacctc agaccaccac tggtgcattc cattcactgt gaaaggcaac cccaaaccag cgcttcagtg gttctataac ggggcaatat tgaatgagtc caaatacatc tgtactaaaa tacatgttac caatcacacg gagtaccacg gctgcctcca gctggataat cccactcaca tgaacaatgg ggactacact ctaatagcca agaatgagta tgggaaggat gagaaacaga tttctgctca cttcatgggc tggcctggaa ttgacgatgg tgcaaaccca aattatcctg atgtaattta tgaagattat ggaactgcag cgaatgacat cggggacacc acgaacagaa gtaatgaaat cccttccaca gacgtcactg ataaaaccgg tcgggaacat ctctcggtct atgctgtggt ggtgattgcg tctgtggtgg gattttgcct tttggtaatg ctgtttctgc ttaagttggc aagacactcc aagtttggca tgaaaggttt tgttttgttt cataagatcc cactggatgg gtag. It is sometimes possible for the material contained within the vial of "NTRK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.