CENPL cdna clone
CENPL cDNA Clone
Gene Names
CENPL; CENP-L; C1orf155; dJ383J4.3
Synonyms
CENPL; CENPL cDNA Clone; CENPL cdna clone
Sequence
atggattcttacagtgcaccagagtcaactcctagtgcatcctcaagacctgaagattactttataggtgccactcctctgcagaaacgattagaatcggtcaggaagcagagttcatttatcctgactccacctcgaaggaaaattccccagtgttcgcagttgcaggaagatgttgaccctcaaaaggttgcattccttctgcataaacagtggactttatatagtttaactcccttatataaattctcctatagtaatctcaaagagtattctagacttctcaatgcttttattgttgctgaaaagcaaaaaggacttgctgtggaagtgggagaagacttcaacatcaaagtgattttttctactctcctaggaatgaaaggaacacaaagggacccggaagcatttcttgtccagggtctcattttgtcacccaggctggagtacagtggcacgatcttggttgactgcaacctctgtctcctgggctcaagtgatccttccaccttagccttccaagtagctgggactgcaggtgcatgccaccacactcggattgtgtcaaaatctcaattgccatctgagaatagagaaggtaaagtgctgtggactggctggttctgctgtgtatttggagacagtcttctggagactgtttcagaagatttcacctgtctgcccttattccttgcaaatggagcagagtctaacacagcaataattggaacttggtttcagaaaacctttgactgttatttcagtcctttagcaatcaatgcatttaatctttcctggatggctgccatgtggactgcatgcaaaatggaccattatgtggctactactgaatttctttggtctgtaccctgtagccctcaaagtctggacatttctttcgcaatacatccagaggatgcaaaagctctatgggacagtgtccacaaaacacctggggaggttacccaggaagaagttgacctattcatggattgcctttattcacatttccatagacatttcaaaattcatttatcagccacaagattagttcgtgtttcaacatctgtagcttcagcacatactgatggaaaaataaagattctgtgtcataaataccttattggagtgttagcatatttgacagaactggcaatttttcaaattgagtga
Sequence Length
1173
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
20,886 Da
NCBI Official Full Name
Homo sapiens centromere protein L, mRNA
NCBI Official Synonym Full Names
centromere protein L
NCBI Official Symbol
CENPL
NCBI Official Synonym Symbols
CENP-L; C1orf155; dJ383J4.3
NCBI Protein Information
centromere protein L
UniProt Protein Name
Centromere protein L
Protein Family
UniProt Gene Name
CENPL
UniProt Synonym Gene Names
C1orf155; ICEN33; CENP-L
UniProt Entry Name
CENPL_HUMAN
NCBI Description
CENPL is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006) [PubMed 16622420].[supplied by OMIM, Mar 2008]
Uniprot Description
CENPL: Component of the CENPA-CAD (nucleosome distal) complex, a complex recruited to centromeres which is involved in assembly of kinetochore proteins, mitotic progression and chromosome segregation. May be involved in incorporation of newly synthesized CENPA into centromeres via its interaction with the CENPA-NAC complex. 3 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 1q25.1
Cellular Component: cytosol; nucleoplasm
Molecular Function: protein binding
Biological Process: DNA replication-independent nucleosome assembly at centromere; sister chromatid cohesion
Research Articles on CENPL
Similar Products
Product Notes
The CENPL cenpl (Catalog #AAA1272208) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggattctt acagtgcacc agagtcaact cctagtgcat cctcaagacc tgaagattac tttataggtg ccactcctct gcagaaacga ttagaatcgg tcaggaagca gagttcattt atcctgactc cacctcgaag gaaaattccc cagtgttcgc agttgcagga agatgttgac cctcaaaagg ttgcattcct tctgcataaa cagtggactt tatatagttt aactccctta tataaattct cctatagtaa tctcaaagag tattctagac ttctcaatgc ttttattgtt gctgaaaagc aaaaaggact tgctgtggaa gtgggagaag acttcaacat caaagtgatt ttttctactc tcctaggaat gaaaggaaca caaagggacc cggaagcatt tcttgtccag ggtctcattt tgtcacccag gctggagtac agtggcacga tcttggttga ctgcaacctc tgtctcctgg gctcaagtga tccttccacc ttagccttcc aagtagctgg gactgcaggt gcatgccacc acactcggat tgtgtcaaaa tctcaattgc catctgagaa tagagaaggt aaagtgctgt ggactggctg gttctgctgt gtatttggag acagtcttct ggagactgtt tcagaagatt tcacctgtct gcccttattc cttgcaaatg gagcagagtc taacacagca ataattggaa cttggtttca gaaaaccttt gactgttatt tcagtccttt agcaatcaat gcatttaatc tttcctggat ggctgccatg tggactgcat gcaaaatgga ccattatgtg gctactactg aatttctttg gtctgtaccc tgtagccctc aaagtctgga catttctttc gcaatacatc cagaggatgc aaaagctcta tgggacagtg tccacaaaac acctggggag gttacccagg aagaagttga cctattcatg gattgccttt attcacattt ccatagacat ttcaaaattc atttatcagc cacaagatta gttcgtgttt caacatctgt agcttcagca catactgatg gaaaaataaa gattctgtgt cataaatacc ttattggagt gttagcatat ttgacagaac tggcaatttt tcaaattgag tga. It is sometimes possible for the material contained within the vial of "CENPL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
