SEC24D cdna clone

SEC24D cDNA Clone

Gene Names

SEC24D; CLCRP2

Synonyms

SEC24D; SEC24D cDNA Clone; SEC24D cdna clone

Ordering
Cat. Num. AAA1272149 For Research Use Only!

Sequence

atgagtcaacaaggttacgtggctacacctccgtattctcagcctcagcctggaataggcctttctccacctcattatgggcactatggggatccgtcgcacacagcatctccaacaggtatgatgaagccagcagggcctttgggggccaccgccactaggggaatgttgcctccgggtcccccacctcctggaccccatcagtttggtcagaatggagctcatgccactggtcaccctccccaaagatttccaggccctccacctgtcaacaatgtggcatcctcacatgcaccataccaaccctctgcacaatcttcttatccaggtcctatatccacttcatctgtcacccagctgggcagccagctcagtgctatgcaaatcaacagctatggttcaggcatggctcctccaagccagggaccccctggccctctgtcagccacatcattgcagactcctccacgacctccacagccttccattttgcagcctggatctcaagttcttccaccaccacccaccacactcaatggtcctggtgcctcacctttgcctctaccaatgtacagaccagatgggctctctgggcctcctcctccaaatgcccagtaccagcccccacctcttccaggccagaccttgggtgctggatatcctccgcagcaggcagccaactctggtccccagatggcaggcgcacaactgtcttacccaggaggcttccctggaggtcctgcacagatggctggtccgccacagccccagaagaagctggatcctgactctatccctagcccaatccaggtgattgagaatgatagagccagcagaggaggacaagtttatgccaccaacaccagaggccagatccctcccctggtcactacagattgcatgatacaagaccaaggaaatgccagtcctcgattcatccgttgtacaacatactgttttccatgcacgtcagatatggctaagcaagctcagattccattagctgctgtcatcaagccctttgccaccattccttcaaatgagagtcccctttacttggtaaatcacggcgagagtggaccagtcagatgcaacaggtgcaaggcctacatgtgcccatttatgcagttcatcgaaggaggaaggagatatcagtgtggattttgcaactgtgtgaatgatgttccaccattctatttccaacatctggaccacattggaagaagactggaccactatgagaaaccagagttatctctaggatcttatgaatatgttgccactttggattattgcagaaagagtaagcctcccaacccaccagcctttatcttcatgattgatgtttcatatagtaacataaagaatggacttgtcaagctcatatgtgaagaactgaagaccatgctggaaaaaattccaaaggaagagcaagaagagacgtctgcaattcgagtgggttttatcacatataacaaagttctccatttctttaatgtgaagagtaatctggcccagcctcagatgatggtggtgactgatgttggagaagtctttgttcctttgttggatggtttccttgtcaactatcaagaatcccaatctgtgattcataatttgttggaccagattccagacatgtttgcagactctaatgaaaatgagactgtctttgctcctgtcatccaggctggcatggaagcactaaaggcagcagactgtcctgggaagctgttcatcttccattcttccttgccaactgctgaagcaccagggaagctcaaaaacagagatgacaaaaaactggttaatacagacaaagagaagatacttttccagccccaaacaaatgtctatgactcattggccaaggactgcgtggctcacggctgctctgtgacactcttcctctttcctagtcagtatgtggacgtggcctcgctggggctggttcctcagctcactggaggaaccctttacaaatacaacaatttccagatgcacttggatagacaacaatttttgaacgacctcagaaatgatattgaaaagaaaataggctttgatgctattatgagggttcgtaccagcacaggtttcagagccactgatttctttggtggaatcttgatgaacaacaccaccgatgtagaaatggctgccatcgattgtgacaaggcagtgaccgtggagttcaagcacgatgacaaactcagtgaagacagtggagccttaatccagtgtgctgtgctttacacgacaatcagtggtcaaagaagacttcggattcacaatcttggcttaaactgcagctctcagctagctgatctttataagagctgtgagacagatgctcttatcaacttctttgccaagtcagcttttaaagcagttcttcaccagcctttgaaggtcatccgggaaattctagttaatcagactgcccatatgttggcatgttaccggaagaattgtgcaagtccttctgcagcaagccagcttattctaccagattccatgaaagtattgccagtgtacatgaattgcttgttgaaaaactgtgtactactcagcagaccagagatctcaactgatgaacgagcataccagagacagctggtcatgaccatgggtgtggctgactctcagcttttcttctacccacaacttctgcccatacacacgttagatgtcaagagtacaatgttacctgctgccgttcgttgctctgagtcccgtctttcagaagaaggaatattcttactggctaatggtctacacatgttcctgtggttgggagtaagcagcccaccagaactgatccaaggaatatttaatgtgccatcttttgcacatatcaacacagatatgacattgctgcctgaagtgggaaacccatactctcaacaactcagaatgataatgggtattatccaacaaaagaggccatattcaatgaagctcacaattgtaaagcagcgagaacaaccagaaatggttttccgacagttcctggtagaagacaaaggactttacggaggctcttcttatgtggatttcctttgttgtgttcacaaggagatctgtcagctgcttaattaa

Sequence Length

3102

Vector

pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

23273493

NCBI GeneID

9871

Molecular Weight

113,081 Da

NCBI Official Full Name

Homo sapiens SEC24 family, member D (S. cerevisiae), mRNA

NCBI Official Synonym Full Names

SEC24 homolog D, COPII coat complex component

NCBI Official Symbol

SEC24D

NCBI Official Synonym Symbols

CLCRP2

NCBI Protein Information

protein transport protein Sec24D

UniProt Protein Name

Protein transport protein Sec24D

Protein Family

Protein transport protein

UniProt Gene Name

SEC24D

UniProt Synonym Gene Names

KIAA0755

UniProt Entry Name

SC24D_HUMAN

NCBI Description

The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Uniprot Description

SEC24D: Component of the COPII coat, that covers ER-derived vesicles involved in transport from the endoplasmic reticulum to the Golgi apparatus. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the Golgi complex. COPII is composed of at least five proteins: the Sec23/24 complex, the Sec13/31 complex and Sar1. Interacts with TMED2 and TMED10. Ubiquitously expressed, with higher amounts in placenta, pancreas, heart and liver. Belongs to the SEC23/SEC24 family. SEC24 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 4q26

Cellular Component: cytosol; endoplasmic reticulum membrane

Molecular Function: protein binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; antigen processing and presentation of peptide antigen via MHC class I; COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport

Disease: Cole-carpenter Syndrome 2

Research Articles on SEC24D

1. three mutant SEC24D alleles in a rare autosomal-recessively inherited skeletal disorder characterized by pre- and postnatal bone fragility, skull ossification defects, craniofacial dysmorphism, and short stature

Similar Products

Product Notes

The SEC24D sec24d (Catalog #AAA1272149) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtcaac aaggttacgt ggctacacct ccgtattctc agcctcagcc tggaataggc ctttctccac ctcattatgg gcactatggg gatccgtcgc acacagcatc tccaacaggt atgatgaagc cagcagggcc tttgggggcc accgccacta ggggaatgtt gcctccgggt cccccacctc ctggacccca tcagtttggt cagaatggag ctcatgccac tggtcaccct ccccaaagat ttccaggccc tccacctgtc aacaatgtgg catcctcaca tgcaccatac caaccctctg cacaatcttc ttatccaggt cctatatcca cttcatctgt cacccagctg ggcagccagc tcagtgctat gcaaatcaac agctatggtt caggcatggc tcctccaagc cagggacccc ctggccctct gtcagccaca tcattgcaga ctcctccacg acctccacag ccttccattt tgcagcctgg atctcaagtt cttccaccac cacccaccac actcaatggt cctggtgcct cacctttgcc tctaccaatg tacagaccag atgggctctc tgggcctcct cctccaaatg cccagtacca gcccccacct cttccaggcc agaccttggg tgctggatat cctccgcagc aggcagccaa ctctggtccc cagatggcag gcgcacaact gtcttaccca ggaggcttcc ctggaggtcc tgcacagatg gctggtccgc cacagcccca gaagaagctg gatcctgact ctatccctag cccaatccag gtgattgaga atgatagagc cagcagagga ggacaagttt atgccaccaa caccagaggc cagatccctc ccctggtcac tacagattgc atgatacaag accaaggaaa tgccagtcct cgattcatcc gttgtacaac atactgtttt ccatgcacgt cagatatggc taagcaagct cagattccat tagctgctgt catcaagccc tttgccacca ttccttcaaa tgagagtccc ctttacttgg taaatcacgg cgagagtgga ccagtcagat gcaacaggtg caaggcctac atgtgcccat ttatgcagtt catcgaagga ggaaggagat atcagtgtgg attttgcaac tgtgtgaatg atgttccacc attctatttc caacatctgg accacattgg aagaagactg gaccactatg agaaaccaga gttatctcta ggatcttatg aatatgttgc cactttggat tattgcagaa agagtaagcc tcccaaccca ccagccttta tcttcatgat tgatgtttca tatagtaaca taaagaatgg acttgtcaag ctcatatgtg aagaactgaa gaccatgctg gaaaaaattc caaaggaaga gcaagaagag acgtctgcaa ttcgagtggg ttttatcaca tataacaaag ttctccattt ctttaatgtg aagagtaatc tggcccagcc tcagatgatg gtggtgactg atgttggaga agtctttgtt cctttgttgg atggtttcct tgtcaactat caagaatccc aatctgtgat tcataatttg ttggaccaga ttccagacat gtttgcagac tctaatgaaa atgagactgt ctttgctcct gtcatccagg ctggcatgga agcactaaag gcagcagact gtcctgggaa gctgttcatc ttccattctt ccttgccaac tgctgaagca ccagggaagc tcaaaaacag agatgacaaa aaactggtta atacagacaa agagaagata cttttccagc cccaaacaaa tgtctatgac tcattggcca aggactgcgt ggctcacggc tgctctgtga cactcttcct ctttcctagt cagtatgtgg acgtggcctc gctggggctg gttcctcagc tcactggagg aaccctttac aaatacaaca atttccagat gcacttggat agacaacaat ttttgaacga cctcagaaat gatattgaaa agaaaatagg ctttgatgct attatgaggg ttcgtaccag cacaggtttc agagccactg atttctttgg tggaatcttg atgaacaaca ccaccgatgt agaaatggct gccatcgatt gtgacaaggc agtgaccgtg gagttcaagc acgatgacaa actcagtgaa gacagtggag ccttaatcca gtgtgctgtg ctttacacga caatcagtgg tcaaagaaga cttcggattc acaatcttgg cttaaactgc agctctcagc tagctgatct ttataagagc tgtgagacag atgctcttat caacttcttt gccaagtcag cttttaaagc agttcttcac cagcctttga aggtcatccg ggaaattcta gttaatcaga ctgcccatat gttggcatgt taccggaaga attgtgcaag tccttctgca gcaagccagc ttattctacc agattccatg aaagtattgc cagtgtacat gaattgcttg ttgaaaaact gtgtactact cagcagacca gagatctcaa ctgatgaacg agcataccag agacagctgg tcatgaccat gggtgtggct gactctcagc ttttcttcta cccacaactt ctgcccatac acacgttaga tgtcaagagt acaatgttac ctgctgccgt tcgttgctct gagtcccgtc tttcagaaga aggaatattc ttactggcta atggtctaca catgttcctg tggttgggag taagcagccc accagaactg atccaaggaa tatttaatgt gccatctttt gcacatatca acacagatat gacattgctg cctgaagtgg gaaacccata ctctcaacaa ctcagaatga taatgggtat tatccaacaa aagaggccat attcaatgaa gctcacaatt gtaaagcagc gagaacaacc agaaatggtt ttccgacagt tcctggtaga agacaaagga ctttacggag gctcttctta tgtggatttc ctttgttgtg ttcacaagga gatctgtcag ctgcttaatt aa. It is sometimes possible for the material contained within the vial of "SEC24D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

SEC24D cdna clone