PBX3 cdna clone
PBX3 cDNA Clone
Synonyms
PBX3; PBX3 cDNA Clone; PBX3 cdna clone
Sequence
atgaaccttctccgagaacagagtagaacacgtcccatttctccaaaagagattgaaagaatggtgggcatcatccatcgaaaatttagttccattcagatgcagctcaaacaaagcacttgtgaagcagttatgattttaagatcaaggttccttgatgccagacggaaaaggcgtaacttcagtaaacaggccacagaaatcttgaatgaatatttttactcacacctcagcaacccctaccccagtgaagaagccaaagaggagctggccaagaaatgcagcatcacagtgtcacagagtcttgtaaaggatccaaaagaaagagggagcaaaggttctgacatccagccaactagcgtggtatccaattggtttggcaacaaacgaatcaggtacaagaagaacattggcaagtttcaggaagaagccaacctctatgctgcaaagacggccgtgacagctgcacacgcagtagcagcagctgtgcagaacaaccagaccaattcgcccaccacaccaaattccggttcttctggttcttttaacctcccaaattctggggacatgttcatgaacatgcagagtctgaatggggattcttaccaagggtcccaagtcggagccaatgtgcaatcacaggtggataccctccgtcatgttatcaatcagacgggaggctacagtgatggccttggaggaaattcactgtacagtccacataatttaaatgctaatggaggctggcaggacgcaacaactccatcttctgtgacttctcctacagaaggcccaggaagtgtgcactcggatacctctaactaa
Sequence Length
825
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,175 Da
NCBI Official Full Name
Homo sapiens pre-B-cell leukemia homeobox 3, mRNA
NCBI Official Synonym Full Names
PBX homeobox 3
NCBI Official Symbol
PBX3
NCBI Protein Information
pre-B-cell leukemia transcription factor 3
UniProt Protein Name
Pre-B-cell leukemia transcription factor 3
Protein Family
UniProt Gene Name
PBX3
UniProt Entry Name
PBX3_HUMAN
Uniprot Description
PBX3: Transcriptional activator that binds the sequence 5'- ATCAATCAA-3'. Belongs to the TALE/PBX homeobox family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: DNA-binding
Chromosomal Location of Human Ortholog: 9q33.3
Biological Process: anterior compartment specification; posterior compartment specification
Research Articles on PBX3
Similar Products
Product Notes
The PBX3 pbx3 (Catalog #AAA1272094) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccttc tccgagaaca gagtagaaca cgtcccattt ctccaaaaga gattgaaaga atggtgggca tcatccatcg aaaatttagt tccattcaga tgcagctcaa acaaagcact tgtgaagcag ttatgatttt aagatcaagg ttccttgatg ccagacggaa aaggcgtaac ttcagtaaac aggccacaga aatcttgaat gaatattttt actcacacct cagcaacccc taccccagtg aagaagccaa agaggagctg gccaagaaat gcagcatcac agtgtcacag agtcttgtaa aggatccaaa agaaagaggg agcaaaggtt ctgacatcca gccaactagc gtggtatcca attggtttgg caacaaacga atcaggtaca agaagaacat tggcaagttt caggaagaag ccaacctcta tgctgcaaag acggccgtga cagctgcaca cgcagtagca gcagctgtgc agaacaacca gaccaattcg cccaccacac caaattccgg ttcttctggt tcttttaacc tcccaaattc tggggacatg ttcatgaaca tgcagagtct gaatggggat tcttaccaag ggtcccaagt cggagccaat gtgcaatcac aggtggatac cctccgtcat gttatcaatc agacgggagg ctacagtgat ggccttggag gaaattcact gtacagtcca cataatttaa atgctaatgg aggctggcag gacgcaacaa ctccatcttc tgtgacttct cctacagaag gcccaggaag tgtgcactcg gatacctcta actaa. It is sometimes possible for the material contained within the vial of "PBX3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
